Description :
From Genome Similarity Track
Location :
Scaffold_136:50283- 52216
Transcript NameFunction/comments
Phymu_g5237myosin-like protein

Sequence
1933 bases(100 bases per row)
ATTTGCACGAACCTGCGATTCTACAAGTGTTGAGACGACGTTTTTTCCATGGAGAGATCTATACGAGCACAGGGCAGATCTTGGTGGCTATGAATCCGTT
CAGAAGACTGTCGTTGTATTCGGACGACATCAAGGACCGGTACTACGATCTCGGAGGAAACGCCGAAGCGGACAAGAGCATTCTAGCCCCGCATGTGTAT
TCAGTCGCGGATCAAGCATTCCGTACAATGTTGGTGCCTCGATCAGGCGATAAGAAGACGGATCAAACCATTCTTGTGAGCGGAGAAAGCGGCGCTGGTA
AGACGGAAACCACCAAGCTCATCATGAACTACCTGGCCTATGTGTCGACCAAACGTACGCGACGTCCAATTCGAGCAAGCAATTGCGACCAGACGACCAT
TCACGACCGAGTGTTGGAGTCAAATCCGATTTTGGAGGCGTTCGGCAATGCAAGGACAACGAGGAATAACAATTCCAGCCGTTTCGGTAAGTTCATTAAG
CTCGGGTTTACTTCCTCGGGCGAGATGCTGggcgcctccatctccacgtaTCTGTTAGAACGTGTCCGTCTCGTGTCACAGGGCAAGGGAGAGCGCAACT
ACCATATTTTCTACGAAATGTGTGGCGGCAGTTCCTCATCCGAACGCCAGGAACTGGCACTGCGGGATGTCCACGATTACGCGTATTTAAACCAGTCGGA
ATGCTATGAACGTCTGGATGGAGTGGACGATGCCGAATCCTATCAGGTGACGCGACGAGCTATGTCAAGCATTGGGATGAGTCCTGatgagcagctcaat
gtcATGAAGATTATCTCGGCCGTACTGCATTTGGGCAATGTTAGCTTTACGACAGCTACTCGCAACGGTGGAAAGGATGATGCGTCTGTGGTAGATATGG
ACGAATGTGCCGACAATATTCAGGCGATTTGTTCACTTTTGGGtgtggaagaagatgtgTTGCGCAGCACACTGTGCACAAAGCAAATTAAAGCTGGCGC
GGAGTTCATTACCACTCGCCTTCCGGTTGCACAGGCACTTTCGACGCGGGACTCAGTGGTTAAGACTCTTTACTCCAACCTATTTAACTGGCTTGTGGAC
CGCATCAACCGAAGTATCGAGTACAAAGAGGAAGCGGGAGGCAACCAGTTCATTGGTGTCGTTGATATTTTCGGTTTTGAGATTTTCGAGCAAAACCGAC
TGGAGCAATTGTGTATCAACTACGCCAacgagaaactgcagcagttgtTCGGCAGGTTTGTGTTCCGAATGGAGCAAGACCAGTACGTTGCTGAAGAGAT
CCCTTGGAAGTTCGTGGATTACCCCAACAACGACGTGTGTGTCGCGCTGGTGGAAAAGCGACACATGGGTGTTTTTTCTCTTTTGGACGAGCAATGTTTG
ATTCCTCGCGGCAACGACGAGAAATTGGCGAACAAATACTACGAGTGCTTAGCAGGCAAGCACGAAAGCTTTTCCGTGTCTAAACTTCAGCGTGCCAAGG
GTCAATTTGTGATTCACCACTATGCCGGCGATGTCTGCTACATGACGGATGGCTTTTGTGAAAAGAACAAGGACCACATGCACACAGAGGCGGTGGATTT
GCTGCGCACGTCCAAATTCGCGTTCGTGCGTGCATGCTTCGAAAACAAAGTCAACTCTGGCAGTGCTAGCCCAAGGAACGGTCGGACTGAATCTCGCGGC
AGTGATGGCCGTCGCCGATCTGGTGGCATCATGTCGTCCACGGTCGTAGCACAGTTCAAGAGCCAGCTAAGTTCGCTTTTGGATGTGCTGAATGCAACGG
AGCCTCATTTCATTCGGTGTATTAAACCAAATGATCAGGCAAGCGCGTCGCAGTTCGAGCGGCGGCGTCTCCTGGAGCAACTacgctgcagtggcgtgct
ggaagcagTCAAGATTTCTCGCAGTGGCTACCC