Description :
From Genome Similarity Track
Location :
Scaffold_60:50276- 51806
Transcript NameFunction/comments
Aphas_H257_14818Hypothetical protein

Sequence
1530 bases(100 bases per row)
TCACCGCGCACGAAAAAGGTGGCGATTGTTCGCGATCCAGACATGACTAGCGTGCTGCCGCAGTCCACGTCATACAACGTATATCCGTTCCAAGGGCTCC
AGTCTCCCCCCAAGGCTCCCCGGACTGCCTCCAAAACGTACCATCTCTTTATCTCTTTATCCTCAATACGATTTATTCACAATTGCTCTAGGCCACCCAA
ACGACTCAAACAACTCGACAAACCAGCCTTGTACGTAGTTCTATCGATACCCCCTACAAATTGCCCTTTTGACCACCATCGTAGCGCCCAAACCACGGCC
GTGCAGCAGAATCCGTCGTGGTTCCCCATGACTCGGCCGTACTCGCCTCTTGGCACGGTGTCCCCCACAGCTGTGATGCATCACTTGAGCGAAGAACAGC
ACCCCCACGTCAAGCCCCACGACTTGCGCCAAATCGAAGCGTGGCTGCTCGGGTTTGAACAAGAGGCGCAGTCGTTCACGTCGTACTTTTTGTTTTGCGA
GCTCAAGTTCCAGCAGTCCGCCGTGTTGGCTACGGGTCGCGATATCCCGAATCGTCTGCGCACGGCGGTGGCCTTCTACTGCCTCCAACAAGCGTCGTCC
ATTTTTGGGCGGTACCAGTCTGTCCTGGACACGATTTGCGTGTAGGAACTCGTCGAAATTCGTGCTTTTCCTGATATTTGTCGATTAAGATATGTGTAAT
TTGGTAGGAATTTGGGGTCGGCCATCTACACGAGCTTTGCCACGTTACGGCGCGGCCGACACCTCACCGCCCTCGAGTGCTACCACGCGGGGCTTACCTA
CTTTGACCAAGTGAATTCGTTGCAGCACGAGAACTCGTCGTTGCATTCGAGTACCCCCTCGTTCGTGAGCCACGAGAACATTGCCATGGTAACGACACTA
TGTAGACAAATCGACGGTCGACGAGTTGCTCGTGCGACTCGAGCAACGGGTCAAGGAACTCGAAGCCGAAAACGCCGACCTGCGCTCGTCCTTGGCCAGT
GGCAGCTACGGGGGTAGTTCTTCCTCAACGACGACCCAAGCCGTGAGCGCGTTCACCAAGCTCGCGTTAAGCAACGACTTCAACCCCGCCGCGAATATGG
AGAAACGAGAGAAGATGGGGTACATCCTCAAGACATTCAAGGCCCTCCAAGGCAACGAACAGATGCAAGTGCTGCTCAGCCAGATGGAGCTGCTCGGGGC
GAACGCTGAAGTGCTGTTTAATATGATCCACGCTCTGCCCAGCCTCGAACGAAATACCCTGCTGGATCGCCTTTTCCAAGACAAAGTTCAAGTCATGCGC
TCGTACGTCTACGAAATGGCATCCTTTCTCGTCCATATGTTACGCTAATTTGGATGAGGAGTTTGTTTCTGATGGCGGCTTCTTCCTAGGCAATGGGCGA
CCGAAGCGGCGGTGCGTGTAGTGCAGCAGCAAAACGACGACGCCAACCAGCACAAGCAACGGCTTGTCAAGTACCAAGCACTCATCCAGGACGTTCTCGC
TGGGATTCACGTGTCTGCGCTGGATATTCC