Description :
From Genome Similarity Track
Location :
contig_135:50276- 51688
Transcript NameFunction/comments
g13670.t1ETL91145.1 hypothetical protein L917_10281 [Phytophthora parasitica

Sequence
1412 bases(100 bases per row)
CCAACGGCGAACTGATTTCGAAGTTGCGAATTCGGTCAGCAATGAGCACGAGCTGCTGCAAAATGGCGTGGTCTGGCCATTGCGCCAAAAGCGACTGAAC
CTTAACCATCAGCTGCTGCAAAGGTTCAGCAACTAGGACGACTTCCTTGACCAGCGGGTCTCGGTGAAAGTCGATCCCGCGAATGTAGTCACCGTTCAGA
GCCTGAAACGATGGCACAGCCCCCTTCCTCGTACCCACACTGCTACCAAGTCGAGCTTGAACCAACGAGGCAGCCAGGACTCCTGATGATGCCACAGCAC
TTTCAACTGCGGTAGACGCCGTGGCGTTCAAAGACTTCCGCAACTTTACTGCGAGAGAGAACGCCCTTGCGAACGTGCTCACAATCTCCTCCTTTGTGAT
AGCGATCACAGAGTTGGAGGTTTCTGCATACAGTTTGACGTGCGTTTCACAGAGGCGCTGCATGATTTTGTCTGTGATGAGCACAATCCATGTCCGCTGC
TGTAGGGAGAGATGCTCCTTCGGCACCAGCAGCAGCCGCTTGCTCCGGGCTCAAGAATGCCTGGAAATCACGGCCACTGTAGTCTGGGAATTGTTCTCGG
TATTCTTTCTCCAGTAGCTCTTCCTCGGTCTCAATGTCCAACTGCCGCATCTTGTACTTAAACTGCTCTTCCTCCTCCTTTCGCTTTTGCTCTTCTCGTT
CTTTCTGCTCTTGCCATTTCGTTAAGAACAGATCAAAGAGGGCTTTGCTGCTTCCAAGTGCAGTGTCTACTGCCGTTGAGTCAAGTGAGCGGTTTGTGCG
TGAAGTGATCAGAGTTTCGCGGAAGAGGAACTCCATTTTCGCCAGTGCGACGTCTAATAGAGCCACCTCGACCTTGCGCTTGTTCGATACGCCAGCACCG
AACAAGATCGACGTCGCAGCCGTACCAACAGTTCGCAGCATCAATTGAATTCCATACCAAGACTGATCCACTGTGTTCACGTTCAGGGCTGACGGGAACT
GCACAAGTGACAGAGCCAAAGTCTCCTTCTGCTGCTCCTTTAGCGAGGTTTCCTTCAGCTGCTGATACAGCGACCAAGTCACAAGGGCAATACCTTCCTT
CACGCAGTAAATTGCCGCCGCTACTGGCTCCAAAATATCCCGGAAACACTCACCAAACTTCTTGGACAATTGCGCAAGGAAGCTCTCCGAGGTCTGCTGG
AACATATCGAGTTCGCGTAGCAGCTCGCGTTTCCGCTGCTGAGATGATTTCGATGATCGCACCGTTGAAAGCATCGCTGATAGCTTTCCGGCAGGCATGA
CCGTGGTATTAAAGCGAAGGAGGTCGCGGAAAAGTTCCCCAAACACAGAAGTCGCCACAGTCTTCATTTCCATCTCACTCGAGCCCACAAACTCCGCGTC
ACCATGCCGCTT