Description :
From Genome Similarity Track
Location :
scaffold_6:50272- 58074
Transcript NameFunction/comments
g389.t1 hypothetical protein PHYSODRAFT_493567
g390.t1 hypothetical protein PHYSODRAFT_351598
g391.t1 conserved hypothetical protein
g392.t1hypothetical protein

Sequence
7802 bases(100 bases per row)
TGGAGCATATGCCGTCAGCACAACTTTGTAGAACTGTCACGTACCTCCCCTGTTTGGGTCGGTACCTGTGGCTGTTTGGGTGAGTACAGTCCTGGGTGGG
GCCTTGAGTTCGTAGAAGTAGAAAGTCTGTAGAACGCTTTAAGTAATATTGTGACTTTCATTCGAATTTGTGAGAATAGCCTCAATCGAATCGTTTTCGC
GACTCGATTTCAAATCGATTCGTGCGATATTCAGCCAATCAGAAGTCACCAACCGACCGCCTCACAAAACATAAAGAGACCCGCCCTGCAAGCCCAGACA
AGCAACCAACGAAGATGGCAAGCATTCAGCAGGCGGTTAATGGGCGCCACGCATCAACAAACACTATTATGCACGCTCTCTACGGCTATTTCTATCTGGG
CTTGTCGAAACAGCGACTGGCGACGATCTACAACAAGCACATCAACACCATTTCAAACTGGATCCAACGCTTCGAGGCCGACAACGACTACCAGCGACGT
TCTACAAAGCAGAATGGTCAACTCACGGCAGAGCAGCGAGAGTGGCTGCTGGGCTATTACACGAGGCACCCGGTTACCTTTCTTGATGAAGCGAAGGCTG
CGTTTGAACAGAAATTCACACGCTTCATCTCAATCTCAATAGTGTGGAGGGCGCTGCGGCAGCATGGGCTCACATGGAAGGTTCTTGAACGACGGGCGAT
GAACATCAAGACCAGCGATATTGTACGCTTCACGCTGGAGCTGAACGCGATCAAGTGGTGCCAAATGATCATCCAGTTCCTCGATGAAGCCAGTTTTGAC
AACAGGGGCATGCTGCGCACGCGTGGTTACTCCTTGAAGGGAAAGAAGCTCGCGTTTCGTGGCGAGTTCAATCGAAAGGCACGAGTGTCGTTGCTTTGCT
TCATCTCTGTGGATGGCCTCGTGGAAACATTCCACACGGATGGGACGTTTGACCGCTCCAAGTTCGTCGAGTGCTGCCGTGTGCATGCTCATTCGCGGAA
GACTGTGCACCAATACCCAGGAAGAGGCTCCGTGTGGATTCTGGACGGTGCCAAGATTCATTGCCACCCCGATATCGTCTACTACCTGCGCTCACTGGGG
ATTATTCCTATCTTTCTTCCTGCATACTGCCCATTCTACAACCCCATCGAGTACCTCTTTGGTTTGATCAAGAAAGCATTCAAGCGGCAGTACGTCGAGT
GGTCCAAGCAAAACCAAGCCATACTCATTGCAAATGTGCTCCAGCAGTTCCAAGATTTCGACATGACCCACATTTTCGAGCACTGTGGGTGGAGTGTAAC
CGGTGAGTTTGACCCTATGTCGGCCCTGGGGGATGAGTACGTGAGCTCATCGGGAGGTGAGCAATTCGTCGTGAGCGACTTGCTGGAGTTTTCGGAGCGA
GACGATCCTGATTACGACAACGAGTGTTCGAGTGATGAAGATTAAAGAGATGCATGTTTAGATTTTGGGCTTCAAGAACCAGATGTATTAGGCATGGTCG
ACGTCCTCTCGATTCGGAATAGCAGTCAACGCGGACGTGACCTCCGTGCTATCTGGTTGTATCACCACATCTTCACCCAGTGCCTCGATCACATCCATAT
GATTCTCCAGCATTTGGTTCATGGACACGATGGAAGTATGCAGCACTTGGACCGTTTGCTCGAAGTGTTTGATCTTTGCCTGCATGCCTTGTACGACCTT
CTTTGTCATCTTTACGCTGCGCTGCACACGCTGTAAGTGTTGGTCGCTTGCGTTTGACGCAGGCCTAAACTGAGTCACCAGATTTGGTGGCGGCCCCTTG
GCAATTTCTCGCTCGTGCTGAGGTCTTGGTTTCTTGATGACGAATGAAGCCCACAGACGCCATGATATATCCTGTGCAGTGAACGTAGCACCCCATTTCT
CCTTCAGCGAACAGATCATGAGTTGGTGGAGTTCTTCTGTCGCAGCACCTCCCCGATCGGTTGCGGCCGGACCAATGCACTGGTCTTCAAAATCTGCTAG
ATGGCCAACGGTTGATATCTCGTTGCCGTACCTGTAGACAGAGAGCAAGACTGTTTCGCGCTGGTTTTTCGACAGATATCGACGATCCTTCGCACTTGTC
CATGGATCCAGCATCTTGGTGTTCATCCCCATGGACATGTACTTCTCGAACATCTTAATTGCTGGGGCATGCTCATCAACTGTCCATACCGGTGGAGTTC
CAGTCAGAACTGCTAATGGCTTCAACTCGCGCTGGATGATGTCCCAAAGCTTGGTCTTCACCTCGTCCCATGTGTCGCATTGAATGCTGTGTGTGCCAAT
CCGCCCTGACGATGACAGACGCTGGTTGACAGTGTTCTTCAATCGTACATCGACTGAGAGTTTGATCAACGGATCGTGCGAGGAAGCCGTCTCTCGCAGC
AGTTCAAGACGTGGACTTCGCCTCTGGTACGGCGAGGGACGAGGATTGGGGCCTTGTGCTGATCGGTCTTGGCTGGGTGTGTTGGCATCGAGCGAATCGC
GCCGCGGAGATCTGTGCCGCACTGGGGTTGCTACGTTCTTTGTGAGCGCAGACGCTACACCGACCTTGGATTTTGCCTTAGCGTGAGCACCAGTTGAGTT
ATGCCCCGTATGGCTGACGACTGGGAAAGCCACGGACGTTGGGGTCGGTCCTGAAGATGGTTTCTTCAACCCGAGCGCCACACAGCAGTCATTTGAGCAG
ACCCGGACGTTTAACTCGCATTCGTGTATGTTGTTTGAGCACATATGGTGCACAGGCATCTTGCAGGACGAGCTGGCCGCTACTGCAACGTCTTTTCCGT
CCTCACATGGGCATTCAACGAACGCGCATTTGCCTAGCATGGCTTGAGTTTCTGTTTGCCCTTGGTGACGGTGAAGTGCAGACGTCCGCCACCTCTGATT
GGTCAAAACCCGGTTTCAATCGATTAAAAAAACCTTTAATTTTCCCCCAGGTTCTACAAATTTGGGTGAAAACGACAATATGAAAACGTAAAGTCTTGTT
TCTTCTTCACTCAACTGGGAAAATTCGCAACTCACAGAAATAAAAGAGGGAGCATTGCACCACGCTCCTAGGGACGACACCTCGTCTCCTTCACTCACCT
AGCACCTTGACATGCCACCCGTCCTTGCAGTAGCGCCCGTCGCCCACGAAGACCTTGGCGAGAGTGGCTTCTCCCTGCACTTCTCCTTGCTCATTGGCTC
GAGCAACTTCGCCAGCTTCCCAGGCACAGGATCACCTTCGTCTAGCGCCATCATTTCCAGAGTCTCATCACCCTAGGGGTACTGACGGTACCATAGGCGT
ACCCCCTGGGTGATGTAGCCATTCGCCTCGACCGCGTCCTGGGTCTCACCCTGGCTTGGCTAGAGTCCACCACCCCTAGAATAGGACTTGCATTCCCGGA
TACGGGACAGAACTTGAGCTCAATTTCATGACGCAGCGGTGCAAGCCGTTGCAAATTGCAGCACCTTGATAGATTCCCCGGCGACATGACTGCTGCAATG
TCTTCATCACAGAATTCATGTTGCGTGCTGCAAGGTGGCGCGTGCAACAACCTTCGTCAGCAGCTACATGTACGTCAACAGATAACCTCAACTTGGCTCA
AAATTAGTGACGCCTATACCAAAAGGTATAAAAACAATAGTCCTTGCGACAGCCGAAAAAAGTACTCTTTAACTGCGCTCATCATTCCGGAAGAAGACCC
GGAAGATCTCAACCTACCGCCGCGCCATGTCCAAGAAGCCCGAGCCGAGCCCCGTGCGCGTGCGACTGGCCACCCACGCAGGCTCCTGGTACTCACATGA
CGAGCATGAGCTGGAAGGCGAGCTCTCAGGTGCGTGCGTCGCTTTGTCCAGCCTAAAAAGGTCCTACCGCTAATTTCCTTCCTGTGACGGGGACTGAATG
CAGGTTGGCTGGACGCCGCGGAGGACAACGACACGCAGGAGAAGCAACCAAGCATCCGCGCCATTATTGGGCCCCATGCAGGTTTCCGGTACGCTGTCAC
AATGATCCATTGCCTGGAAGATGACGCTGATGTTTGTGTTGCCAGATACTCGGGCCCAACGGCTGCGTTCGCGTACCACCACCTGCTGGACTTGGACCAC
ATTAAGCGCGTCTTCATCCTGGGCCCATCGCACCACTTCTACTTGCGGTGAGTTTATAGTTGCTATAAAATGGAGGTTCTGGTGCTCATTTGTTTGTTGT
AGTGGATGCGCTGTATCGACTGCGCACGAGTATGAGACGCCGTTGGGCAACATTGCCATCGACCATGAAGTGAACGAGAAGCTCGTGGACTCGGTGGGTT
TAGGAGCACGTGGAGGTTGTGGATGTTTGCTGATGCTTTTGTTTCTAGGGCAAGTTCGCGACCATGTCGATGGACGTCGATGAGGATGAGCACAGCATTG
AAATGCACCTCCCTTTCATTTATAAAGTGATGAATGGCCGCAAGTTCACGGCGGTCCCGATCTTGGTCGGCAACACCAAGAGCAAAATGGACGAGGAATA
CGGAAAGTATGACTTTAAGTTGTTTCGTTCGCTGTAGTGCACCTGTTGAACGGTAGATTTGACACTTCTTGCTGTGATTTTCAGAATTTTGGCCCCGTAT
CTGGAGAATGACGAGAATCTGTTCGTGATCAGCTCGGACTTTTGTCACTGGGGACCTCGGTAAGCGAGGGAGTTGTTGATGGAAACTTGGTGCGTTGACT
AACGATCTCTTACTACTATGTTGCAATATTGCTTCGTTCAGGTTTCGCTATCAGCCGCACGACTCGACCTATGGCGAGATCCATGAATACATCAAATATT
TAGACCACCAAGGCATGGGTGTAAGCGAAGACTGCATTCCTCTACGCGTCTATGGTTTATTGTTTTGATACTGATGGTGGTTCGTTGTTGTATATGTAGT
TCATTGAGCGCTTGGACGCTGAGGGTTTTACGAGATACCTGGATGAAACAAACAACACAATTTGCGGTCGCCACCCGATCTCGCTGTTGTTGCACAGCAT
TTTGGCTTCCAAGAAGTTAAAGTTCGCGCTTAAGTTCGTCAAGTACGCTCAAAGCAGTGCATGCATGCGCCACGGGGATTCTTCCGTGAGCTACGCATCT
GCCATCGTCTACAGCGAGCCGTAGCCCAAGTTCCGGACTTCCGGACCACTCAGCCAGCATGATTTGAGTGAAAGGATTGAGCAGCAGCATCTTTCTTCAT
TTGCGTACAGCTAAGTAATTTGCATTCATCTAAGCGTTCACTGCTGCGGTCATGTGTGTGGTGATTGCACTTCTCATCTTAATTAAGCTGATTGTGCATT
GTCTAGGTTGTTTCTAGTTCGCCCCCTGCTTCTCCGCAGCAGCCTTCTCTTTCCGGATCGTCTTACAACTGGTCTTGTGGTTAGTCCAGTCCTCTACCTG
GTGATCCTTGCAGCAGTAAAACGCCGCCTCACAGGCACAACTGAGCAACGTCGTTGCAGTTTCCGCCCCTTCCTCTTTCCGCGTTGACGAGCCGCAGTAT
CGGCAACCAACCTCAGCCGCACTAACCTCTCCGACCATCACCTGCTTCAAGAACATGGTCTCGAACGTGTGAGCCACGTTGGTAAGCAGCGTGAGAATAA
CTTGCTGCCGCATTTGCAGGGTAAGCCACACATCGGCTTCCATGAGCTTGCCCTGCTTGATCAGATTCTTCTTCTCCTCGATGATATCCGGTGACGCTGA
AGGAAGCAGCGACTGCACATTGTGCTCCGGGTCCGCCAGATCAATAAAAGCCAGTGACACGTGCTTGAACGTTTCTCCCGAGAACGTAGGCATGGTTCCG
GTGGAACGCAGCGACACCAGGTACAGTAAATCGTGGCGACTGCAGTGGTCGGTCTTGGTAGCGCGCGCATTCATGAGACGAAGAAGAACCTTTCCGTTCT
CCTCCAACAACGCCTTGAGCGTCAGCTCGGGAGTCAGCAGCTGTGTGGCCTGCGGACGCGGCTCCTTGGGGTCGTATGACAGCGGAATGTCGGGCGACGC
ATTACGCAGCAGCGACACTTGACCTGCGTAGGGAAGAGCCAAAAACCAGCGCATGAAGGACGACGCATTGTTGCGCCAAAAGCGGGTCAGGTACTCGGCG
GGAGACTCCTCCTGCACTGAGGCCGTAGACGCTGTAGTGTCAGCAGCTCCAGCCATCGCAGCGGAGATTTGGGCGAAATTATCCAGTGGTGTGTGATACA
TAAAACATCTTTGAAAAAGCACAAAACCTGAAATTTAGGAAAACTTTTGGTTGGACGGTACTACCGGTAGTATTTTCCAAATACCCGTATACCGGTACAT
GTAGGTACGAAACGTAATGTAGCCAAACCTCGCCTCGACGACACCGTGAGGTTGACTGTTTTCCATGAGCACGCCCACGACAGCCCCGCGTTGCTTGCCT
GCGACTAATAAACTGTACCCTGGAAGTCCGAAAGTTCGGAATCGGAACTCCCCACCAAAAGTTTTTGGCAAAAACCATCGCTGCCATTTTCCAGCTCGGT
GAGGCACCTGGTCCGTCGCTGGGACACTCGGCATCTGCAGCGCAAACTTCGCCCCCAAACGATTAGACTGGCATAATGCCAGTGGCATTTGGCGTGATCA
ATGCGGCTCTGTGGCTTCGAGCAAGGCGGCTAAATTAATTCCGCAGCGTCACGCTGCCAGTCTGGCACTGCTGCCCGCTGCCATGAAAGCAAATACAGCA
CTCACCGTTACCGAACCGGTGCATTAATTCTCGGTGCAGACGAGCACACGGCATCGTGTGGAGCAGGGGCGAAAATCCAGGCGGACGTCGATATCGACGC
ATCTGGACGACAACTTGCCCCCAAAAAGAACAGCCTAAATATAGCTTATGGCAATCTGTTGTGCGAATTCCCAGCCTGCCTTCCCAAACGCCACTTGTCT
TCCAGAAGTGCCAACGCATCTGCGTGCCAAGTTTAGCGGCGCCTGAAGCGGAGCCATCACGAGCGGATCCGGTCTCCGCTTCCTCGTCGTCTGGTGCCGT
ACCTACACACGCGTCCAAGGTTTTTCATTAGAAAATCGCCATTTCATTGGTTAAAAGGCCCTCACTGCGAGGTTTTTAACCCGGCCGTGTGGTTGTGTTG
CACACACACTCTGGTCCTGAAGGGCTAGGCGTGCCTATCCCTTCCTGCTGGCTAACCGCCCGAGTCAAATCGCGTCGCGGCCACTGCGACCAAGAGCTGC
TGCGTAGGTTCGATCTCTCTCTGCGCTCCCCCCCGCGCCTTTGCGAGTGACCCCCGGACATCGACAAGTAGGCTTGGAACCCCACTCGCGCCGGGACCCC
AACGCGCGTCAACGTCGTCTCCTGACGCCGACCAGGACGTACTGACACCGAGGGAACCTCCTCACCCTTTTTTAGAACTCTTTTAACAGCAGCCATGGAG
GTCGGCGCCCCCGTGTGGATTTTCGACAATGAATTGTGGCACGAGGCAGTTGTTGCCGCGCCTGTGGACGCTTCCTCGGGACTTGTGGAGTGTGCAGTCG
AACCAGACACTAAAGACGAACACCTTGTGACCCCCGAGGGCGACGACGTCGTCCCTGACGCACAGGAATTCCAGACGCCGCGCAGACGTCGTAACTCGCG
ACGCAACTCGATGAAACGGACTGTTAATATTCAGGCGGAGCTGGTACTTCCGCGCAGTCAGGGAGAACACTACCACGCGGTGCAGGACCTGACGAAGCTC
GTGCATTTGCACGAACCTGCGATTCTGCAAGTGTTGAGACGACGATTTTTCCATGGAGAGATCTATACGAGCACAGGGCAGATCTTGGTGGCGATGAATC
CA