Description :
From Genome Similarity Track
Location :
Scaffold_329:50255- 56725
Sequence
6470 bases(100 bases per row)
ACAGGTCGGTGGTTCGAACCCACCAGGGCACAGCCCTGTCGTTCCATGAACGATTGTTCACGCTTGGACAAGCTTAAGGGCAACACCCGTTTAGCTCAGT
GGTCGAGCGTTGGCTTTGGAAGCCACAGGTCGGTTGTTCGAACCCACCAGGGCACAGCCCTCTCGTTCCATGAACTGTTGTCCTTGAATGGACAAGCTTA
AGGGCAACGCCCTTTCAGCTCAGTGGTCGAGCGTTGGCTTTGGAAGCCACAGGTCGGTCGTTCGAACCCACCAGGGCACAGCCCTCTCGTTCCATGAACT
GTTGTCCTTGAATGGACAAGCTTAAGGGCAACGCCCTTTCAGCTCAGTGGCCGAGCGCTGGCTTTGAAAGCCACAGGTCGGTGGTTCAAATCCACCCGGG
CGCAGCCCTCTCATACCATGAGTAGTCCGTTCTCGGACTGACGTACGGGCATCGCCCTTATAGCTCAATGGTAGAGCTCCGGCCTGTTAAGCCAAAGGCC
AGTGGTTCGATCCCCGTCCGGGACACCACTTTCGCTGTTAAAGCGCATCCACATTTGGATCATGCTCATCGAGCAAGTTGTTTCAAAACAACTATGCGTC
TATCGAGACGCTTGTGCCTGAACCTTGTTCAGCACAACACGAAGCACCTGCTTCCTTCGGGACCATGTCCCTATCACCACGAGGTCTCTCCACCTCCTGC
TCCCGCTGCGAGCACCGCTCATACGTACGAGCTGGCTGCTGCAGCCACTGGTCAGAGCCTGAGCTCAACTACTGACCTGATCGCTCCCCACTCTAGTGGG
AGGCGCCCAGCGCCTGGCGACGCTGTCGCACGCCATGGTGGCGCTTCGGCACATGATGTGCCCGGTCGTAAGCGTCAACGACGTCAGGGCAATCTTGCCG
GAGGATAACCTCAAACTCCCATGAGTTCTGTGAGTGAGGGTAACCCCTCCACTTCACTAAGTACTAGGTACGCCCCTGGCGTCTACGCCACGCCACAAGG
CGTTCCACGTGAAAGTGGAGCTCACCATGCTCATCGAGCAGAGCAGGAGGAGGCCTTGCCTCAGCTGGGCTCTCGCGGGGAGAGTCAGCACTTGCCGGAA
CGGCGTCTGCGTCCATACGACGCCGGCGTCCACGACGCAAACGTTCACGTTCACCGCCCATCGGTCGATCTCGAAGAGATGATCTACCTTGTGGATAGGT
TAGAGCCACCACTGTTGACTCACAACCAGGTCTCGGACCTTGAGCGTCCAGTTGCTCGGCTGAACGTTCAGCTTGCCTTGCTCCTTCACCTCGAGCACTT
CGCTCCGCGACCTGTGGCTCTGCCACATGCTGTTGATCAGCCATCTGTGGATCCACCACTTGCTGTCGTTCAGCCTCCCGTGGCTCTACCACCTGCTGTT
CTGCAGCTGTCCGTGGCCCAGCCACCGTTGGTGCCAACGCCTCCGCGCTCACCTGAGCAGGGTCTTGATATGGCTTAAGCAAGCCAACATAGAAGACCGG
ATGCGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCCTGGCCACGACCTTAAATGGTCCTATGAACCGAGGTCTTAACTTCGTTTTG
AAGACTGCAGACACTGCATGAGTAGGTAGGTTTCTAGCGTTTAATAAAACTTGGTCTCCGACCTCAAACCTCTCAACATTGCTTCTGCCCTTGGCATCTG
CATGTTCCTTCTGCGTGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTCAGTCTCAAAGAGACAAAGTCATCGACTTGCTTGCGAAC
CGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCATCAAGCCCTGAGCCACTGCGTGGCGGCGTCAGTGGGACGCGAGGGTGAACCAAG
ACGTTCACATAGAACGGAGTGTAGCCTGTCGAGGCGTGCACTGCATTATTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCT
CAGCGCATACGCTTCGGAGGGTATCCTCCACAACGCGATTCACGCGTTCGGTCTGACCATCGGTCTGCGGATGGTCCGCTGTGGACATGTCCAAACGAGT
GCCGAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCGG
TCTAAAAACAGCAAAGCTGTACCTTCACCATCAATGGTGTCCGGCACTGCCGCTAAATGAGCCATCTTGCTCAATCGGTCTACAAAGACCACTTTACCCG
TGTTTCCCGCCTTATCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAACATCCCTTGGGGACAGGCAAACTCGCCAATGGCGCTGCCGT
GCGCGGCGCGGACTTTGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACTTATACATCTTGGGCCACCAGTACATCGAGCTCACCGAG
CCATAGGTCTTCTCCCGACCTAAGCGCCCACCCACGGGCGTATCATGAACCTCATAGAGGATTCGATACTTTAGATCCTCATCATGAGGAACGACTACAC
GAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCGATCGAGTGAGTATCGATGCAGCCTCGCGCGTAAGCGCCCAGACAATTCCTTGTCAGA
GTCTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTCAGGCACTGACGACGTCACT
GTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCATGTACTTCACCTCGAAGTTATACTCGG
CAAAGAAGGAAAGCCATCTTGCCATTCGCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATCAGTAAAGATCACAAAAGGCTTAGA
GCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTATTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTGAGCTGGCGA
GACTCAAACGCAATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGAC
TATCCGGGTCCGGTAGCGCAAGGATCGGAGACTGGAGGAGGCTCCCCTTCACAGCCTCAAAGGCTCCGTCGTGCTTGACGTTCCAGCACCATGGTGCGTC
CTTCTTAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTTGCGCTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCCTTT
TGGTTCTTGGGAACCGGCCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCGTAAGCCTCGCTTCCCAATGAAGCACCCGAGGAAAGGTATTTCCT
CCGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAGCTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGTGGTCAATGTGGTTTTCCACGTCTGA
CTTTCCGTGCTCAGCACGACTATGGACGAATATATCGTCAAAGTACGTTTGAGCGTACGCCCGGTGGGGCCTAAACAACTGCGTCACAAGACGATTGAAC
GTTGCTGGTGCGTTCGACAGCCCCTGGGGCATCACCAGCCACTCCCAGAGCATATCGCTCGGAGTACTCACCGCTGTCAGCGGAATGTCGCTCGCTCTCG
TGAGCAATTGGTAGTAGCCATCGACCAAGTCGAGCGCGCTGTACAGCGTACAGCCTACCATGTTGTTCTGCAGAACATCCTTGCGAGGAATCGGCGTTTG
CGCCGGGATAGTGGCCGCATTTAGCTTGTTAAAAGCATGAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGTGGGTGTCGAGTGCGGAGAC
TTACTCTCACGCACCATACCTGCCTCGTGCTTTGCACGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGCAAAGGCCATTGCCTTGTTACGCAGT
ATTTGGTTCCAGGAACCAGGTCAATCTCATGACACACGCCTCGATCCGGAGGCAGGCCCGTCGGTGGGTCTTTCGAGACAACGTCTCCATACTCCTTCAC
CACCGGGTAGAAGGGATCCGAAGGATCTTTGAGGATCGCCGATCCACTTCTTGCGCTCAGCGCCTTCTTGGTGTCCTCTAGGACCGCGTCGTCCACGACG
GATGAGGAGCTCAACTCCTCCTCAGGTCCCAGCAAGACCACCTCGGCTAGCTCGCCTGCCTTTAAGGCTTCGCCAAACTCGGCAATGGACATCTCGTCCA
GCTCTAGCAGAGCATCTGCAGCGGGCAGAGTATCAAGGCTGATATCGCCTTCTACCTCCCCCGTCACTCCGTTCACGAGTGTATACAGCTGTTCACAGCA
ATCACGTGGAGCATCACCGCTCGTCACGTTGGACACATCGTCCGACGTCGAAGACGTCACAGACGCCCTGCGTCTTCGTCTCCTCTCCCTCCGCGACCGA
GCCCGGCCGGATGAGGGCGGTGTGGCGACATCTCCGTCACCACCACCGGGTGCAGCAGCACCATCACTCCTCGAAGAGGATACAGTGTCTCGCAAGACAC
TCGGCTGAAAGCCAAGAGGTTCTTGACCTTCACACAGTGAACTAGGTGTCACTTCACCTGCATCTCCTGGGCCACGCCCATGATGCCTCGACTCGCGGTC
GACCGCGACCCTCGGGTCACGCAGCGGTAGGTCATCGACCAGATGCATACCACTCAGTGGATTACGTGCCACTCCGCGCTCGTCCTCGCCAGGACCCAGC
AGCTGGTCATTGACCTGACCTGCACCGCTCAGCGGATGACGTGCCGCACCACGTACGCCCTCAGGGCAAACAGCAACCTCGTTGCTAACAATTTCGGACA
TACCAATGTCCAGCACTACGGCCGCCTCGGCCTCGTGCTCGCGCCAAAAGCGCTTCTGCTTCCTAGCAGAGGTGGGTTCATGACTCACCAAAGCTCCACT
AGGAGCAGGGTGCGACGCACCCAGCGTTTTCGACTTCCAGTCGATCTATGGCTCATGGCGTTCCAGCCATGCCATGCCAAGGATGAGGTCATACCTCGCA
TCCAGGTCTAAGACCAAGCAGCGTTCCACGCTATCGAAGTTCTCAAACTTCACTCCAAGGTCGACAGAGACCTTCGACACAGTTACCAGTGTCCCCGTCG
CGAGACGGACAGAGATCGTATCTCTCGTTGGCACTTCCAGTGCCTCAGCATACAGCTGACTCCCTTCTAGGGTGGAGCGACGGGCGTAGTTGCCCGAGGC
TCCCGAGTCAATCAAGACTCTCCATGGCTTTGCAAAGCCCTTCACGTTCGCTTGAACGAACCAGCAAACCCGGCTTGCACACACTCTTCTCGTAAGAGAG
CTCAGCTCTCTTCGGGGCTGAGAGCCCGTTGCCCTCTACCTCCTCGATGTACAACAGAACTCAGATCTTTCCCCAGTAGGGCGCCCCGCGCCTACTGGGA
AATGCCGTTTTCCAGCGGTGAGCCGGAGGGTTGGCTCGCCGGAGCCACGCGCTTCTTGCGCAGAGGGCAATATGCCCTCAAGTGCTTAGTGCTATTGCAC
ACAAAGCATCGGCGGATGCCGGCACGCTGCTCCGCAGCAAGAAGCTCCGCTTCTTCATCTTCAGCATAGCTGAGGTCCATCGGCTCTGGACCGCTCGAAG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AAGAGAGGAGTCCACAAGTTCGGGACGGGTGGGAAGGGTGGGGGGTGACCAGAGTCCAGCCAGGTCGGCCGACCTGAAGTCGTGCTCGGCATTCAGAGGC
CACATCCACCGCCTCTTCAAAGAGATAGGGTGTACACGGAACACTTCTGTTCGAGCTGCGCTCACACGAAGTCCCTCCATGAACACGGTCACGCTGAGCA
ATTCCGGAAGAGGGTCCCCCGCCATTCCGGCGATAAGAGTTCTCAACTCTTGGACATAGTCCAATAAATCCTTCTTACCCTGGCGGGTAGCAAGGAACTT
TGACCGGATACGGTACGCCTGATTAGGCGGCGCGAACACGCGCGAAAGCTGTTGCTTCAGCTGATCCCAAGTGGGAAATGCAGCGTCAACAGACGTGCCG
CACGTTAGTGCCCATTCGCGAGCGCGACCTCCAAGCCTGGAGATAGCCAGCGCCACGCGCTGATGCTCAGACTGGAGCAGAGCCGATCCCATGGCCATCT
CGACCTCACGGGTCCAGAGAAGGAGATTCTCTCCATCCTTCCCCTCGAAGGTTTTTACGCTCACCATGAG