Description :
From Genome Similarity Track
Location :
Scaffold_275:5025- 6972
Transcript NameFunction/comments
Phypl_g6321hypothetical protein PHYSODRAFT_506356

Sequence
1947 bases(100 bases per row)
TGACACAAGCGATGGCACACCGGACAAAAACCCATTCGTTAACGATGCCGACATTTGGGAAAGTATTTTCTTAGCAGACGTACCTCGCTGCCGAAGATTG
CCGAGTATTGGGTGATCATGTCaaaccagctcgtccgctTGATGTCGATGACTTGGATAATCTACAAGCGGTGACGACGCAAAAAATCATCAGGAAAGGC
ACTAGCTGCACGTATATGATGGACAGGTTGGTGCGCATACATATTGGTACGGGTCGGAGGACGAGATACCTCGACTCAAGGACGACAGCCACACATTTCT
GCACGCAAGGAactcctccttgagctgctttTCGTACTCCAACGATCccacagccgcagcaccgtcCTTCTCAACAAGGCCATCCAGACGTCGGAGATAC
CCCACGACCCGAACACACAacgccagctgcaggtcctcgcgaagcttctgcagcaattTCTCGCGCATGGTGCTGGTCATCTCCGCCACCTCGTGCACCA
AGCAGTCAATCACCACATTGCGAGACGTGTCGGCGTTTTCATCAGCCTGGAACGTCTCGTTGGCGAATTGAatcacgtccagcgccgaaTCGAACAGCTC
GTTGTGGATGCACGCCTCCAACAGTTGCgggatctccagcagctccgtcaacTGACCAAGACACCACACAATAATTGCAATAATTGCTGCGTAAAGTGCC
AGCCAACTTGACAGCTAAAAAAACACTTTCTTATACCTGCAGATAATGCTCGAAGACGAATTGGATGTCGCCATGCTTGGCCACGACATCTGCCACCTCC
TTCTGGAACTCGGCGCAGTATTCTAGGAGCTCTGGGATGGCCGCTTCGATCTTGGtcgtctcctccttgagctccgccagctGCATGAGAGGAAACAATA
TATATTGTTGGAACGGGGAAGTAGGTGTCAATAATATTTTTCATGCGATCAAGTTGTACGCACGTCGTCCTTGACAATGGCGGCGCACTGGTTGCTCTGG
ATGAAGACGTGgtagttcttgagcacgagGTTGCGCAGCTGCTCAGCCGTGTTGTCCGCCTGGATCTGCAGCCGCCAcggctccttcttgagctcctcga
gcgagCACGTcttgagcgacgacgccagcatcgcTTTCGTGAGTTGCTGACAGGATCACCCGGGTATTGTTGAAAATATTTTGCGCAATCTTTTCAATAC
ATGACGTAATATTTTGTAAGTGGGCGCTTTTCGAGAGCGGGCACGGTACGCTCCGTGGATCACATCAGCCTGGCCGAGGCACCGGCTTGGCGGTGGCGGT
CCCTTTGCCTCGATGCTCGTTTTGCAAAAGCGTTCATCCATGCGGTGAAAATATTTTAGGTAGCGCTCAGTGCACCCTCACGTTACCTCGGTGACGGATC
CCGTACAAGTAGCAGCAAGATCACGAGCAAAATGTAGACGCGTATCAAAGCAACGCCCTCTTCGACACGATCATGGTACGCGGCAGGATGCACCCGAGGC
GGATCGTCAATGTGCACTGAGGGCTttggcgctggacctggcgtgaaggagcagcgccgtcatAGTTCTGGTTACCAGCCAACCTTGTTGAAATAATACC
CGCCCAGCGGCGACAAACGCGAGCGCCTTAGTCAGCGCTGACtccagctcgaagcagcCACCGACCCGAAGCAGCAAGCCTGGCGGATCTTTGGGGCCTC
AGCATCAGCTGCGAGGATCGCAGACAATCGTCCCGCGACTCGGCGGTTTCAAACTTCAACCCCTACCCCTTCGTTTACGTGTCACTTGCGACCTCACATA
TTGGGTCTTCAATATATCTCTTCTGACATAGCATTGCCATACTGAAGCCCATATGTGCAAGTTCAGCAGAGACCGATTCAGCTACAGCATCTGCAACTTG
AAACGCAACAGCGGCGACACCGTCCTCGGGTCCACGCccgcgccgtc