Description :
From Genome Similarity Track
Location :
Scaffold_34:502454- 503656
Transcript NameFunction/comments
Phyin_T30-4PITG_14365Putative uncharacterized protein

Sequence
1202 bases(100 bases per row)
CTCGGTGGAAAGCCAGTCGATGTGCTGACACGAGAAGCTCTGCGACAGGAGTTCAAAGAGCTGATGTTCCATCGGGTTGCGAGAGCGATGCGCCATGAGA
ATTCGCGTCTCAGAGGAGGTTGCGAGCGCTTCCAGCGATGTCACAAGCGGGGCGTATCCTTCTGGATCGTAGACGACATCCGAGAGCACGATCACGTCGG
GTTGCAATGGCAGATCGCGCGGTGGATCTCCCCAAAGATGCGCTTGGGCAACGGGTAGTACAGCGCCTTTAGCAGCGCTATCCGCTGCCTCTTGAGGGTA
GTTCAAGTGGATGTTGTAGTCTAGCAACGGAGTAACCTCCTATGTACACGCAGCAGGAAGCACAGGATGAGTACGTTTGAATCAAGTTGCAACAAGCCGG
TGCCTTGCGTACCTCCAGGTCCGTCAAGGTAACCCGTGCACCGAGCAACGAACAGAAGATGCCCACGAGTCCGAGGCCACTGCCAAGCTCCACCACTCGT
TTCCCGAAAAGAATCTCTCGTCGAGCTGCTAGATACCGCGTTAAGACGAGGCACGAGTCCCACAACTTGCCTCCGATACCTAGAATAACCACCCAGCTGT
TAGTCACTGAGCTTACCCTCGGACAGTACGGCGTACGCTACGTACCAAGGTTTCCAGGAGACTCAGCAAGAAGAATGTCATGCTGTAGCCCAGGCATGGA
CACAGCTCGACAGCAGTGGACACCGAGATGTCCAGGATTTCCCTCTTTTAACGCTCCACCACGAGGGTGTACCGTAAACGGCAACGATACCACGGGGAAC
AAGTTCCACGTTTCGGTTGATGACTCGTGTGATCTGATTTCAAGGGCGAGAGGCTTCGAAGTGCTTGACAGTGATGATGCGTCTACAGTGACGACAGCGA
CGCGGAAGCTCGCCTTTCCGCGGCCGTTGAGTGTCAACTTGCCAATTGCATCGGCACTACCGAGATCGCCAGTATCCGACGGGTCCAAGGGCTCTTGGAA
CGTCAATTTGTATTTATTCTCAGTGTTGTGACGTAGAGAGCATTGCAGATAGATTTTCTCTCCATTTTTGACGTAGTCGCGTCGGAAGAGACCGAATTCA
TTGCCAATATTCACATTCACATTGAAAAACTGGTCTAGTGGAACTTGCGATGGTAGCAGACAGCTACGTTGGAAAAATAAAATAAAACCATGATTTAAAA
AA