Description :
From Genome Similarity Track
Location :
scaffold_224:5024- 6439
Transcript NameFunction/comments
Pl_107402hypothetical protein PHYSODRAFT_331237

Sequence
1415 bases(100 bases per row)
GGACTACTCGCACAGTACGCTGGTGTCGGGTTCATCAGTGGAGTGCTACCCGCCATGATCTACCCACTGCTGCAAGGCTATCTCAATGCTGAAGGAACGA
CTGTGGTTTCAGCCAATGTCCTGGTTCATCTACCGTGGTCGTACAAGGTTTTCTTTGGAATTTTGAGCGACTGCTTTCCAGTCGCTGGGTATCGTTGCCG
GCCGTACATGGTACTCGGGTGGGTAACTAGTTGTTCCATGCTCTTCAGGATGGCAAGCTTCCCTGACACAGCACCATACTTTGGAGATCCCACCATGCAT
TCGACCAACCCCGATCAATGGACAGAGGCCCAGCGCAAAAGTATCAATCACAACGCACCCGATACAGCTGGTAAATATGTGATTCCAATGACACTAGTGG
CGTTTGGATACCTGCTTGCTGAAGTGCCAGCTGATGCACTAGTTGTTGAATGTGCACAGCGAGAACCAACGAACACGCGTGGACGTCTGCAGAGTTGCAT
TCACAGCGTGCGCATGAGCTTTCACGCTCTGGGTGCTTTCGTGGTTGCCTGTGCTTTCAACGGTGTCGAGTATGGTGGTTCCTTCGATTTCTCGCTATCA
TTCTCGCAAATGATGTTCATCCTCGGCTGCATCAGCTTGTTGCTAGTACCTACTGCTTGGTATTTTGTTCACGAAGAAGAGATCCAGCCTCCCAAATTCA
GCATCTACATCTCACGGTTTTGGGAGATCCTGCAACAGCGTGTTGTTTGTCAGCTTGCAGCGTATGATTTCTTGTCCAGTGTCTGCAACAACTTCAAACC
CGTTGCGTTTAGCAACATCAAACTGTATTGGGTCCACGCTACGCCGTTCAGCGCGAGCATCATGGCAATCATCGGCACCTTCGTGTACACGGGGACACTC
GGGATCATGGCGCAACGTGGTCTCAACTGGAACTGGCGCGTAGCTATCGCCGTGACGGTTTTGTTTGGGGTTTTCACTGATTTAGTCATGACAATGCTCG
TCACTTGGGATATTGTACGCAACCAGTGGCTATGGCTCGGTGTCCCGATCATCGTGTACATCCCTCACGCTGTACAATTCATTATCGACAACTACGTGAT
CGTAGAGCTCATCGAGTTGGGGTCAGAAGGTGCTCTCTTCGGTCTTTTATCAACCACGACACACGTTGCCACCCCAGTTGGACGTACCGCTGCCAAACTC
ATCAACGCCCAGTTTCACGTCTGGAAAGACGACATCCTAGCGGATGCATCCACAACACGCCGCGATGTGACCATCACGATAATGATCTGTTACGGTATGA
AGCTTTTATCCCTAACTTTTCTACCACTTCTTCCAAGTCAGAAAGTTGCAACACAAGAGCTCCGTCGATACGGTGGTGCAAGTCGACGAATGGATCTCTG
TATGATCGGAATTCT