Description :
From Genome Similarity Track
Location :
Scaffold_542:5023- 10225
Sequence
5202 bases(100 bases per row)
CTTCCTCTGACGTTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTAATAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCATCGCA
AGGTCCAGAGGCGGTCACTGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCG
GCGTCGATGACGCGTGAAGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCC
GTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTGTCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGC
ACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGT
ATCCGGTCAAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGATTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCTC
TTCCGGAACTGGTCAGCGTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCTTAACTCTTTTGAAGAGGC
GGTGGATGTGGCATTGAATGCCGAACACAACTTCAGGTCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGAAC
CTCAGCTATGCTGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGAGCAGCGCGCCGGCATCCGCAGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGG
CCTATTGCCCTCTGCGCAAGAAGCGCGAGGCTCCGGCGGGCCAACCCTCCGGGTCATCGCTGGGAAACGGCAACTCCTAGTAGGCGCGGGGCGGCCTACT
GGGGAAGAACTGAGTTCTGTTGTGCCTCGAAGAGGTAGAGGGTAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGC
CGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTTATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCAC
CCTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAG
GTCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCCGGATGCGAGGTATGACCTCATCCTTGGCATGG
CATGGCTGGAACGCCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTAATGAGTCATGAACCCAC
CTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGAGGTCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCT
GTTTGCCCTGAGGGTTTACGTGGTGCGGCACGTTATCCGCGGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGACGAGCGCGGAGT
GGCGCGTAATCCACTGAGTGGTATGAATCTGGTCGATGGCCTACCGCTGCGTGACCGGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGC
CCAGGAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCAAGAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCGA
GGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGACG
CAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTCGTGAAC
GGAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGATACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTCGGCG
AAGCCTTAAAGGCAGGCGAGCTAGCCGAGGTGGTCTTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACAC
CAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCTACCTGGTGGTGAAGGAGTATGGAGACGTTGTCTCAAAAGACCCACCGA
CGGGCTTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGAG
TGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGCGAGTGTAAATCTCCGCACTCGACACCCACGACCTGTGTCAGAAAGCCG
AACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACA
TGGTAGGCTGTACGTTGTACAGTGCGCTCGACTTGGTCGATGGTTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCC
GAGCGGTATGCTCTGGGAGTGGCTGGACATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCACCGG
GCGTACGCTCAGACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGC
TCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTCTCCTCGGGTGCTTTATTGAGAAGCGTGG
CTTACGGGCAGATCCTGCCAAAGTCGAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTG
CACAAGTACAGCGCGAACTATGCGGAGATGGATCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCT
TTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAAT
CGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAGCTATCCAGTTCAT
GACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTAC
GCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCT
TAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGCTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTAT
GCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGC
ATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAATATCGAAT
CCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAG
TGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGAT
GCTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGACAAGGCAGGAAACACGGGTATTGTGGTCTTTGTAGACCGATTGAGCAAGATGGC
TCATTTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTC
TCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACGGCGGACCATCCGCAGACCG
ATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTAAGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGA
GTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGT
GGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCGATGACTTTGTCTCTTTGAGACTGA
GCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAGAAGGAACATGCAGATGCCAAGGGCACAAGCAATGTTGAGAGGTTTGAGGT
CGGAGACCAAGTTTTATTAAACGCTAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTCAAAACGAAGTTAAGACCTCGGTTCATAGGACCGTTTAAG
GTCGTGGCCAGGAAGGGCCTAGCGTATACTCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTTGGCTTGTTTAAGCCATATCAAGACC
CT