Description :
From Genome Similarity Track
Location :
Scaffold_3:502293- 503610
Transcript NameFunction/comments
Sapdi_VS20SDRG_01300hypothetical protein
Sapdi_VS20SDRG_01301hypothetical protein

Sequence
1317 bases(100 bases per row)
ATCCTCCTTGTCGCGTTTGCCGGCAACGAAAACCTCCAGGCGCTCACGACCTACCTGCACCAAAACCCGAGCTACGGGAATGTGTACTACTACGCGTTCT
GCGGGCCGGCGCAACTGGCATCGATCGTCGGGATCATGACGGGGACGCTCGTCCAGATGTGGTTCAACCCGCGACTGGTCACGCAGACGTGGCTGCTACT
GGTGACCAGTGCCGTCAACTGGATTCTGGTCTTTGTGCTGGAAGCCTACCTGTTTCCGAGCCAAAGCACCAACGTGCCAAGTCCGTGCGCGCTGCCGACG
ACGTCCAACTGCGTTGTGTTCAGCGCCGTTCTGAAAATGCATTTTGTCTCGGCCGGCGTCGCCATCACTGTCGTCGCGCTTGCCATCGCAGCCGTGTACG
TGCACTCGGCCTCCCGCTCGTCGCCACCACCCACGTCCGTGCTATCGTACTTCAACGCGGATCGGTACGAGCAGTTTCTCACGTCATCGGCGGCTTGCGT
CAACGGCAGTGGCGCCGACAATGGCGTCCTCCTCATCAAGAGCATGCTGCGCATCGCGACAGGCGACATGACGCGCATGGCCAACGCGCCGTACGTGCTT
TTTCACATGGTACTGCCGATGAGGCGGCTCCAGCGCCTCTACAGTGACACGGTGGGCTCGCTCCATGTCGTGCATTTGAAAGAAAACGTCATCAGCCGCG
CCAGCGGCTACAAGACACTCGACACGATCGAGGCGTCGAGCGACACGCCGACATGGTGTCGCTAAACAGAAATACACGCGGATGTCTTGAAGAATAGTGG
TGATCGGTCACATGATGGGATATGGGGAAGCTCGAGACAGCGATGAGTTGGCATATCGAGGATGGTTGTTCGCTGTCGCCATGTCGAATGGGGTAGCGTA
TATAGAGTGCCTCGATCTACTGTGTTTGGCCCCCAACGCTCGTCCGTGCATGTCCAGCAACAGCGATTCGCCGAGCAAGATGGAGACCCCAGTCGCTACC
GACCACGACTATTTATAACCTGACGCTGCGAAAGGCCGCGCAGTCATTATTGTCAAACAGACAGCGACGAGATGGAACCAACGGACAAGAACCGGCGTGA
GAGCCGCCTCGTGTCGGCAGCTGCTTTTGTGCGCAAGCGGCTGCCGTTCGGAATGGGCATGGCGCTCTCGCTGCTCTACATGGGCTTTGCGGGTGTCGTC
GCCGTCACGACGTATACGCTCACGTCGATCGCCAACCAACCGGTTTTCACGGGTCTCATCGTCCAGGCCTTTGACTACAACCGGTTTGACGTGCCCGTGA
CAACGCTTCTGCAAGGG