Description :
From Genome Similarity Track
Location :
Scaffold_85:50225- 52416
Transcript NameFunction/comments
Phyci_68789Hypothetical protein

Sequence
2191 bases(100 bases per row)
CGGGGACGTCCGCAACTCGTACTTCGCCGGCTGGCTCGTGGCCTGCTCGCTGTTCGTGGTGCTGCTCAACGTGTTCGCCGTGGTGCTCGTGCAGCTGACG
TACCGGCCGCAGAGAGAGCCCCGGGACGACCCCGAGCAGAGGAGGGAGTGCAGGCACTGGCTCAAGCTGCTCATGACCATGCACTTCGTGGGGCTGCCCA
ACATCGTGCTCATCGCGCCCGTGGTGTTCCCCAACGAGTTCTTCTCGCTCTACAGGGCGAGGGACAAGCGGATGATCCGGAGGCCGTACTTGCTCTTCTG
CGAGATGATCGTGACCGTCCAGCTCGGGTTCATGATGTACGTGGCCGTGAACCAGCTGCTCAATGTGCCCGTGATCGTCGAGTGCCATGATGAGCTGCCG
CCGCGGCAGATTATACTCTTCTACTCGGCGACGGTGGTCTGGCTGGTGCTGCTCCGACAGATCGTGGTTTTCTGCCGCTTCTTGACGCACCTGAAGCTGC
AGGCTGACAGCTCGAACGACTCATCGCACACGTCCGCGCTGGGGAACTGGTTCAAAGCACTGAAAGCATTACCGCTCAGGAGTGAGCGCACTCGACTCGT
GAAGGAGTTCAAGAAATTGCTTTACCGTGCAGTGGCGCGCGGTGATGTTCTCACGGTGGAGACACTCCTGGCTGAGATGCAGTCGAAGTACAGGATTGAC
CGTATCCAGGATCTATACAAACCGCCACTGCTGTGGTTTTACGCTTTCGCCAAGTCGAGGAAGAATCCGCTTCATATTGCTGTCAAACGAGGCAACATCA
GAGTTGTTGAGTTACTGCTGGAGCATGGAATGGACGTTAACGTCCTTGACAAAGTTGTCCGTGTGAACTTCAATGTTGGCCTCGTATTCAAAATCATTAG
TCGCATCCTGGTAAGTTGAATGTCGCAATCTGGGTAATGCAGATCGATGTTGCTGACTTGTATTGATACTCTTGCAGGTTCGAACACAAGATGGCCTTCG
ATCGCCTCTAAAGGCGCTCCTATGCTCGGTACTGCTTCCTCCGCTCCACGGCGCCGTTGCGGAAGGCTACGTTGATATCGTTCGCCTGCTTATTATCAAG
GGTGCGAATGTGAATGCGTTGCCACGGGCCTCATTCTACTACCCCGCAGCCGTTTTACCACCTATCTTTGTGGCGGATGACCCTCAAGTGCTACGTTTAT
TAGTAGCAAATGGTGCTAATTTTCTTCAAGTTGCGTCGGTAGCGCTCACTGGTTTGGTTAGGACCTATGCAACGCCGTTGCAACAAAGTACGTTCACGCT
GAGATCAGACTTAAGTGACTATTTGCTGGAATGTGGTGGTGATGTTGCGCTGACCCCGCTGCATGAGGCCGCAGCAACGGATAACATCGGAAAGATCAAG
TGCCTACTTGCTCGTGGTATTCAGGTTGACACTCTGGGCGAGCGCGTCGAAGGTGTACATCGTAGGACACCGCtgcattgggcagcgattgttggcaaag
tccaagctgcgaagctgttgctagtgaaacgggctaatcccaacgctaaagatcgtgatggacgcacacccttgcactgggcggccagaaacaatcatca
cgaggtggtttcgttgctgctggcttacaacgcCAAAGCTGATGCTGAAGATGACGAGGGGATTCCCGTCGTATGTTTCGCCGCGGAAGCAGAAGGTGTG
GACTCATCTATTTTCTCCAGTTTAGTGGCTGCGGGGGCTAGCCTTCGAACTCAGGTGTCAGGCGGAAACACGGCACTGCATATCGCTCTGCAGCGCGAGA
ACAGGCAGACCGCTGTGTCGCTAATCAAGTGTGGATCCAGCATGATGATTACAAACGATGTTGGTAAACGAGCTGTGGACTGCACGACGTCGACTGAATT
ACAATTTTTGCTGAAGAAAGAGGCTGGAACCCGCAAGATCATGATTTCGTATACGCACACGCATGCGCAGTTTGCTCAAAAAGTTCGAGAGCACTTGGAA
AGCCAAGAACAGCTTACCTGTTGGATGGATACAATGGATCCGAGCGGGATTGGTGGCGGTGCAGTTTGGCGAGAGGAAATTGCACGTGGAATTAATAATT
GTTCGCTCGTTCTCAGTATCGTGTGCGATGGCTACACCAAATCTGAATGGTGTCTCAAGGAGCTTGCTCTCGCCAAGCTACTTCGCAAACC