Description :
From Genome Similarity Track
Location :
Scaffold_85:50220- 52368
Transcript NameFunction/comments
Phymu_g3845hypothetical protein
Phymu_g3846hypothetical protein PHYSODRAFT_285441

Sequence
2148 bases(100 bases per row)
ACTGGATCAGTTGCCCGTACAAGACTAGAGCGGAGATCCACGTGACCTACAACACAGAGCACGCTCGCTACGAAGGACTACCCGATGAATGGCGAACACT
CAATCTTCAGTTTGGCTTACCACTTGAACAAGTTCCCAAGCGCAAGGTAGTAGGGTACGAAGCCAAACTGCCTGCTGTACtggagatgatgaagacCTGC
TTACTAGCGCACAACGGAGCTCGCACTGAAGGAGTGTTCCGCCTAGCGCCAGACCAGAAAGAATACAACGAGGTCAAGGCCGCGATCAACGATGGATCGT
TCGAGGACTGCTCCGACGTACACATCATGGCGTCGCTCATTAAGGTAAATAATACCATCATGATGCTGAGTGTGACTGGTCTCATTTTACTATGCAAGCA
GGTCTGGTTTCGAGAATTACCCGTAAGCCTTTTCAATATGCTAcctgagcagcagatcgctCTCACTTGCGAGCTGGTGGTAAGAAGACAACGAGATGTC
GATACTCAGAACTTTTGTTGATCCTAATTTTCTCTTGGTGTAGGATCCAGACCCCAAGGCCGTTCTACAGTCGCTGAAACCTTTGCCTTTACTACATCAA
ACTGCtgtgctgtggctgctcgACTTGCTGAATGAAGTCATCAAGTACGAGCACGAGAACAAGATGACCGCCAAGAGCATGGGTTCGTTCGTCGCTTAtc
ttattttttttactacatgtagcgttGAAGTCGAATACTTACTCCCCCGCCTATCACAGCTATCGTCATAGCGCCCAACCTGCTTACAACCAAGACGTCG
GACGCTGCGGTCGTCGTCACCACCTATCGACAAGTTGCTGACTACGTGCAGTTGTTGCTACGTGCTCGATCGCAGTCAAGATGACAAGAAAGATAGCATG
CCAAGTTGTTTTTATTGAAATCGTTCCGGAATAATTTAAAACCCTATGCAAAAAAAGGAAAGGTGCAAGCAAAAAGGAGACTGAAAGTGGACAAAGCTGA
CTGTCGACACATCTATCCAAGTACTGAGCTCTCTTGCGTCTACACGAGGCAGCCGTACTCAGGGGAGATGTGGCGAAAGATGTCGTCTTCCAGGCCTTCG
AGGCCGCTTggcgtcatcgctgtcggcTCTTCCGAACTGGAAGAGCCCACTGTAATGGGCTGCTGAGTCACGGCAGTTACTTTCCTCATGGCCATAGTGG
GCGATGGCTGCAAGGGGAAAAAGTCGTATGAGACGGCGTCCAGCGAATAGCCACACGACGGGTGGTCGTTCTCGCCGTAAGGGTCCattgtggtggtgct
gaGCTCGCCAAAAGGGTCGTACATAgcgtcgaagacgaaggcTGGCTGTACCGTGGGCATCAAACCGGCCTGGCTGTATTGGTTGAACTGCGCTCGGCTG
TACTCTGCGGCCGCGTTCATGGCCACGGCAttgccgaagaagaggttCTCGCGGTGCGGAGAGGAGGCCGAAGCCGAGGACGGTGAGTCTGTGAACAGGT
GCTTGCGAGCTTTGTTCCTGTGTACGAAGTGCTCGACGCCCGGTCTGGGGCTCTGCGATCCACATGAGTCCTCGTCTGAGTCGTGGTCGTCGCCTCCGTC
GACGTCACCCTGGAAGAAGTGAGCAGGAAGAATCTGGCCGAAGGGGTCGATGCCGTAGGTCTCGGGCGATAGGAGGCGCTTGAGCTGACTCTGGTAGCCT
GCGAATTGGCGCATTTGTTTGTCCGAGAGCGGCGGGCCCGTACCGTCCTGTGCCTGTTGCTGacactgctccagctcctgcagcgagCGCTTGAGGCTGC
GCACCTTGCGGTACGGCCAGTGGCGGATGCCAATGGCACGGCAGCGTTTCTTGAAGGCTGTGGCGCGTACGCCGAACTTCTCAGCCGCCACTTTTAACGG
CAGGTGGAAGTGACGACTGAGCGCCGCAAAGTTGCAGGTGGCGACGGGTAGCGGCGACGCTGAGCCGTCGGAATCCACCGGCGAATCGCAGgccgcgcgc
ttcttgaagttgtGAGCGGCCACCTGCATCCGTAGCGACTGCTGGGCCTTGTCGGCCGTGGGCGACTGGAAGTTGAGGTGCATGGCCCTCGAGTCGGCGG
GCGTGGGCGTGGCAggcagctccatctccatcttGGCGGGACGAGCGG