Description :
From Genome Similarity Track
Location :
contig_135:50216- 51628
Transcript NameFunction/comments
g11602.t1hypothetical protein

Sequence
1412 bases(100 bases per row)
TGCAAAATGGCGTGGTCTGGCCATTGCGCCAAAAGCGACTGAACCTTAACCATCAGCTGCTGCAAAGGTTCAGCAACTAGGACGACTTCCTTGACCAGCG
GGTCTCGGTGAAAGTCGATCCCGCGAATGTAGTCACCGTTCAGAGCCTGAAACGATGGCACAGCCCCTTCCTCGTACCCACACTGCTACCAAGTCGAGCT
TGAACCAACGAGGCAGCCAGGACTCCTGATGATGCCACAGCACTTTCAACTGCGGTAGACGCCGTGGCGTTCAAAGACTTCCGCAACTTTACTGCGAGAG
AGAACGCCCTTGCGAACGTGCTCACAATCTCCTCCTTTGTGATAGCGATCACAGAGTTGGAGGTTTCTGCATACAGTTTGACGTGCGTTTCACAGAGGCG
CTGCATGATTTTGTCTGTGATGAGCACAATCCATGTCCGCTGCTGTAGGGAGAGATGCTCCTTCGGCACCAGCAGCAGCCGCTTGCTCCGGGCTCAAGAA
TGCCTGGAAATCACGGCCACTGTAGTCTGGGAATTGTTCTCGGTATTCTTTCTCCAGTAGCTCTTCCTCGGTCTCAATGTCCAACTGCCGCATCTTGTAC
TTAAACTGCTCTTCCTCCTCCTTTCGCTTTTGCTCTTCTCGTTCTTTCTGCTCTTGCCATTTCGTTAAGAACAGATCAAAGAGGGCTTTGCTGCTTCCAA
GTGCAGTGTCTACTGCCGTTGAGTCAAGTGAGCGGTTTGTGCGTGAAGTGATCAGAGTTTCGCGGAAGAGGAACTCCATTTTCGCCAGTGCGACGTCTAA
TAGAGCCACCTCGACCTTGCGCTTGTTCGATACGCCAGCACCGAACAAGATCGACGTCGCAGCCGTACCAACAGTTCGCAGCATCAATTGAATTCCATAC
CAAGACTGATCCACTGTGTTCACGTTCAGGGCTGACGGGAACTGCACAAGTGACAGAGCCAAAGTCTCCTTCTGCTGCTCCTTTAGCGAGGTTTCCTTCA
GCTGCTGATACAGCGACCAAGTCACAAGGGCAATACCTTCCTTCACGCAGTAAATTGCCGCCGCTACTGGCTCCAAAATATCCCGGAAACACTCACCAAA
CTTCTTGGACAATTGCGCAAGGAAGCTCTCCGAGGTCTGCTGGAACATATCGAGTTCGCGTAGCAGCTCGCGTTTCCGCTGCTGAGATGATTTCGATGAT
CGCACCGTTGAAAGCATCGCTGATAGCTTTCCGGCAGGCATGACCGTGGTATTAAAGCGAAGGAGGTCGCGGAAAAGTTCCCCAAACACAGAAGTCGCCA
CAGTCTTCATTTCCATCTCACTCGAGCCCACAAACTCCGCGTCACCATGCCGCTTGTTCGGCTGGTAACGTTGGATAGCATGAGCTGACACCTCTATCAC
TTGGCCATGCAA