Description :
From Genome Similarity Track
Location :
Scaffold_118:5021- 6311
Transcript NameFunction/comments
Phypl_g3523hypothetical protein
Phypl_g3524hypothetical protein

Sequence
1290 bases(100 bases per row)
CCGCCGATGTCACTTTCGCTTTGTATTTTCGAAACGGAAGTATACTGTGAATTTAAGGCACTCCTGCTGTTCGGATGCGTTAACCTCGGCCCCAGAGATG
TAGTACTAGCACCACCTCGACTTAACTGCGGCGTCGTCTCGTTCTCCCAACCCTGCAACTTTTCCATAAACGATGCGAGTTCTTTCTCCAGCACTTTCTC
CTCAAGTGTATACTCCTCAAACTGCTGTCGATGGTTCAACCGAAActtcgccagcgctgcttccATCGCATCAATCCTTTCCTGAAGTTCCGATAAAAAC
TGGTCTCCGTTCTCTATCTCTTCCACCTTCGCCTGTACATCGCTCGCTTTGCTGCTCAGCTTCCTTAACTGATGCTTCACCTTATTTACACCCTCCTCTC
GCAACGTCTCCATCTCTTCAATGAGCTTATTCACCTCAGCCGGCGATACAAAGCCAGCAGATGCAGTCGAAACCCCCGCAccagcgaagaagctctgCCA
CGCTGCTCTACAATCtttctccatcgtcgccacccTCGCCCTAtactgcagctgcttctcgctcCATTCCGCCTCCTGCCTCCCCATTCTACGCCTACCA
CCACTCGTATCTTCTTCACTAGACATCGCCCCTCGTCTCCTTACAGCGGCGATCTttctcgtcgtcttggtccTCTCCGCCAGTCGCATTTCATCGCCTG
GTCTCTCGCTGCGCTCTGTCTGCACTCCAAGCCGTGCAGCCGCCACTCTATCCCGCAGTCTGGCAGACGCGGAGACGTTTCCTCTGTTCTGTAGTCGCTC
CTGTATGATGGCGTCTACTGTGCGGGACGCCAGGGGCTCTACAGACTGTCGGACGTCGTAGAGAGCGGAGGAgacgccttcgctgcgcttcagATGTTGC
GCACGCACCTCGTTGTCGCCGGCTTCTCGTAGCTCACGCAGACGCCGtagctgctggccgccaagaCGTCGCGGGCCCATGAGTGCGGAATTGAAGGAGC
GTCGCTTCAACATGAGCCGAAACGAACGTTAGATTGTTTTTGTGGCGTTCGTTATTTGTAAAACAACGTTGGTTTGGCGTTAGATTGGGTAATTGCGGAA
TCCTCTAAGACGGGAGATGgagaggacggcgacgatggacgtggtggtggtcttCCAGCGACAGGAGTGCGTTAAATAGCAGCTACAGGAGGGGGTATAG
CAAGCCAAGATGTGTCCGTACTAACTCGCAGTGCCTGTTGTGCTGCACGACCGCAGATACTACGTGTCCACGCAGGCTTCTCCAGATCGG