Description :
From Genome Similarity Track
Location :
contig_141:50203- 52780
Transcript NameFunction/comments
g13764.t1OWZ18694.1 hypothetical protein PHMEG_0007173 [Phytophthora megakarya

Sequence
2577 bases(100 bases per row)
ACTAGTCACAATGTATTAAATCCCATGTGAAATGCTATAGGGAAATGGTGGCCGTAGTGCACGGATTCCCCAGCAAGTTCCGCGCGCTGCAGTTCGAGTG
GGTCTGGCAGCACCCATCGGTGAGTAAACTCACTAGGAACCATCTTGAGTTCCTGCGAGGCTCGAGAGGACTGGGGGCTCCACGGTCGGTCAAAAGGAAG
GTGGTGGAGATGCTGGAGATGGTCAACCTGGACCCATGGAAGACGCTGAACCTCACCGTGAGCTTCACGACGGACGAGGTGCACGACATTGCGAGGACGC
TGGGGGGCAGATACAGCGCTGCAAAGTGCGACACGAGAGCGTTGATCACTTTTGCTGACGTCACTTCAACTTGCAATTGTTTCGTTTGTGAGTCCACAGT
AGAGGACAGTTTGGATGACGCGGTGGGGTGTTATCATGACGGGTGCGACATGTGCTGCCATCCCGAGTGTTTGGTGGACCATTTTCGGTCCATGAGAGAC
TCGGAGGAGGACGAAGAGACGAGTGGAGAGTGTCCGCAATGTCAGCAGGTTCTTAAGTGCCGTTTGCTGACGAAATATCATGGGGAGAAGAAGAATCGGA
AGAGACGACGTGGTGGACGCAGAAAAGGCGAGAAAAGAGTGCGCGTGGCAACTGCACAAGGGACGAATGATGAAGAAACACACCCTCTGCGTGTTGTGGA
GCAAGGCCCAACTCCAGATGATAGTAGGCAAAAAAGATGCGACGGAGAGGGAGTGGATGCGATTATCATCGGGTCGCCGCCTTCTTCAGGAAGTTTTGCG
GCTGAGTACAATTCGGATGGCTGGTTTGAAGACGATGGGATTTACGCTAACGATGGTGGTGCAGGCTGCAAGGACGCGGAGTCGGAGCAAGACTGGAGGT
CGCAAGCTCCTCTCCACATCCTCGATGTTCATGTGCCCAAACCTGCCAACGAAGATGTGGAAATGATCGATCTCACGGAAGAATAATCCACTTTTTGAAT
GCAATTGGATGAATTGACTGAAGGGGATGGCGTCTATCCGTCCTGAACTTTCGGGATGCACATTGCAACAGGCGAGCAAGGTGCCGTGTAGCAGTCCGAG
TCTACGAGCTCGCAGTCTTCGCGCTCACTACAGCGATCTGGTGAGCATACGTCGGCACAGTACGCAACAACAGCCTCGTCGGGTTCGATCTGTTCAAGGC
ACTCAGTGTAGGCGGGGCAGGTCATCGTTTCACACGTAAGCTCTGTATCCGCATCACATTCGCCATCGTGCACAACTGTGAGCGCGTGTTGCGGGTGCTG
GCACCTCGCGTTGGCAAAGAGACACAGGTTGTCGTGAGTCTGGCCATCGGACCCGCACACGGGCGCGTAGGTGTATGGACAAGGTCCGGGGACGCATGAT
TCTCCACCATTGGCGTTACTGGGTGTGCTTGCGCTACGAGCAGCTAGCATGTGTAGCGGACACTTGCCAGCTCCGAAGGCCTTGATGCTTGGGTTGCGGC
ACTCAGCGTACTCAAGCAGACACGAGTTGGCGTACGTGATACCGTCTGAGCCGCAAACAGGATCATATATGCGCTCGCACATTGGGTTGCATTTCTCCGG
TGCTGCGGTAACTCCTTCGTCGGTGGCAGTCTCTCCGTCGACTTCCAAGACAGCCAAAGCGTCGTTTGCATCTTGGCTCTTGGCACATTCGCCGTGTGAG
GCCTTTTCCAGCTCTGGGTGCTCGCACTTCGACGACAGAAGGTGGCAATCGTTGATGTACGTGACTCCATCCGTTCCACACACTTGGTCAGGGGTCAGCT
TGCACGTGAGAGAGCAAAACACCGTCTTCAGGTCTACTTGGGTGCTGGAATCCAGCTGCTCATTAGGGTCGAGAACTTCGACCTGCATGTCGGAGGGTGG
CGCGCTTGAGACCTCTTCTTGGTCTTGGCTGTCGTCAGTCAAAGGAGGACAAACTCCTAGAGCTCGGATAAAGAGCGTGTCTGGGTCACTTCCCCCGGAA
CAGAACGTTGAGGCAAAGACGCAGTCATTGGCGTACGTGATCCCGTCGGACCCGCACACTGGGTCATACGACACCACCTCGCAGTCGAACGTTTGGGTGC
AGTCGATCAAAGCTGCTGCTTGCCGTCCCACGTCAATTCCAAGCGGTGCAGTAGCAGACGTCCGATCGCCAATGCTGTCGTCTTCACTGTGGCTCTGCGC
AGTGACAAAACTGCAAACAGCCCGAGAAGAGATATGAGTCTCATGAGCCCCTCAGCTCTTGTATGTCGAGGAGCGTTTGGTCCAGATTCGACAATGGTTC
TGATGCTCTATTCTCGATGCTGCGTGGAGCAACCCAAGTCTATCTGCACCAAAATACGCGTACCCGTGAAACTGCATCTGTCACGCGTTCAATATCCGAG
CTCCCTGTGTTCAACGAGTTATTCGTGAATTTGAAACATGGGACGGGAGCAAAGCGTCCTCTTCGAAAATAGTTGGCGCTCATGTTGGAGCAAATCAAGT
TGGAACAATTCACAACGAACTGGTACTATCGACGGAGGAGCCTTTTACCGATTGCCGGGCTTCCTTGGACGTCTGAC