Description :
From Genome Similarity Track
Location :
Scaffold_1272:502- 4812
Sequence
4310 bases(100 bases per row)
ACGTCACTCTTATGCATAAACATTCACTCCTTCCTCCTAATCCACCCTTCCCCTGTGGATCCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAG
CGATCCTCCTTCTCCTGGTCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCAACGGATCCCCTTCCTACTCTTCT
TCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAAC
TGGGTTCGTCATATCCACGCCAATACACTAGAAATGCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCGGTGATCTTCTCAACTTC
GAACTCGTCGTCTTCGAGATCCACAATCCAACTATCTTCCGGTAGAAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGATCTGC
GGCCGATCCGGGTATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTACCAGCTTTACCGCGTGTT
CTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGAT
CCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTGGCTTGCC
GGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCCCGGGTGGATTTAGGATC
CCACCCTTGTACCAAGTTAAATGGGGTATCACCTCGAATCCTGTCTTGCGGTGTTTATCGCGAAGGGGAGTCGTTCTGCGTACTCATCTCAATCCCTCTG
ATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGTCATGGTTGCTCGC
TGTCGCTGGCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGA
AAACACACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAAGTCCACTCAAATCAACAA
TTCTGTGTTTCCTTTGAACGACTTCGGTAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCT
TCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACGCTCTTGAATAGTACCCTCCAGTGGAAACATTCTCGGA
TCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTAATAGTGGTGTAGGACATCCTGCTGTAAGGTTTCCGGCATCACCAGTCG
CATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATGCTGTAG
GATTTGGCATCCTCCCGACTTAAGTCTCGTACATCCCCCATCAGACACTTCTTTAGTCCCAGAATCCACGCTTCCTCGTTCTAAGCTTTGAGGATCCGCT
CAATGCGGACTCTCTTCACAAATGTTTCCTCGAAGATCGGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATCGCCTGGACTGTTCTTTT
CCTGGATTTAACTACCACCACTTCGTCTAGTCGGCTCAATGTAACGAGATCCTGATGCCCGGCTTCTCTCTCCACTTCGACACCACATTGATTCCGTAAA
GCGGCACTGGCCAAGCTATCCGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACTACGCAGGTGGATCATCACTTTCTGCC
GTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCATGCCTCGCACCTGTCTGATTACCAAATTGGAATCCCCACAAATCACCAGCCTTTTTGGATCTTG
TCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCTGCGTAAGTGGATCTGGCTCGTACAACTTCCCAT
CCGGGCAGTCTCCACAGTATTACACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGTCGTACAGATCCTCATCCACCTGTA
CCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGGGCGATCCTAGTCAGCGCCTCATCTATCTTAGCTCGAGGAGTGATGCTCGCGGC
CAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCATGATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAAC
CCGGCCGATATGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCAGGA
TCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTG
CACCAGAGCTGCTGAGACCGCCCAGTCACCGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTG
TTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTCTTCCATGTTCCGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCC
GTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCTTCTTCTGGCGTCGTACCACTTGGATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTG
TTGGATTTTTATCCGTACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCAGCAAACAGGGCATAATCCTCGATGAAC
CGACTGTAGTAGTTCAAACTACCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAACGAAGACAGGCCCTTAGGATTCGCCT
CCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATTCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGCGATATTCCACTTAGTACACGC
CTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACAATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAGCACGGACGGGGTT
CCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAG
AGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGG
ATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAGATCTTCTAACAGCTC
ATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCTATACACAGACGTATATCCACCCCGTTCTTCTTGATGATG
ATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCG
CCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCGCATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAAT
CAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCC
TCTGTGATCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGGTCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAAACTTGCTCATATTCCG
TCTTCGTAGG