Description :
From Genome Similarity Track
Location :
Scaffold_827:502- 2081
Sequence
1579 bases(100 bases per row)
TTTGCGTAGTCTTCCAGTCCGATGTTGTTAGCTGGATGCTCGCAAAAGGCATTCCTTGCGTTCTCCGTTGCTTCATTTCCTTCGGTTGCTAACACTCGAG
CAACCGAGATGTATGTTCCGTCCAACGTCGCTACGGACTCTTCTATCGACTCAACATCGACATCCGCTTTGATGTGAGCACTCGGTACTGGGTCCATCTC
CTTCCCATCCTGGTTTCCCGTCTCAGGGCCACCTGCCGAGTCTTTGTTCGCAATATTGAATGCGCGAACAGCCGACATATTGTGCTGTTGACTTTTGTTC
AGCGCCTCGGATGGTCGATGTCTTGACAATTCGGCATTCGCACCAATCTCGCAACGCACCCTCGGTGCCGTATTCACCACCTTCAGTGCGACGTCTGCAT
CCTCTGGACCAACTACCGATGACTCGTTTGCAAATTTGGCTGCGCACAAGACCGGGATAACTTCGTCAAAACAGGTGACTCCATTTAATCCAGTGCTGTT
ACTTGTCGCTTCCGTGGTTACCCCTGACTGGACACGAACACTCGTTGGCGTATGTACAACGTTTACCGGGCTCAGTAGTTCGTGTGTACGCGCTACCGAG
GCTTCGTTTGCATTATTGCTACCGCCGTGAGCTGTCGTGTAAGTGTCCAAAGGTTCTTCGGAAGACTGACCCTCGGCCGAGTCCCCGGCTGTCACCCCAG
ACGCCAGACAGGCCTCCACTCGTTCACGTTCCTCCATGATCATTGCCCAGCGCTCTGCACATGTCAGACGATCACTAGAGTCCATTAGCGAGTCCTCAAG
AGGCCTTGCTAGCACCCCACTGGGTTCTGGATAGTCTGGTCGCTCGACTGCCGAAGGCTGAGTTGCAAGCCATTGCTCGTAGATTTCACATTCACGCTGA
AACAGCTCGCGGTCTCTGCAACCTTCGTAAGCCAGCACCTTCCAGTCTTGGTACTTTTTGGAATCCAGGCGCACATAGCCGTCGCCTCGCGGCAAATTTC
CATATGGAATCCACATCGCGATCGAGTCGTGTGCTGGTAGGTACACAGCTCGATCAGACACGTTGGTCAATCGAATGCTCTGAGGCCGTCCGCGTCGAAA
CCTCGTCACTGACGGGATTAACTTGTTCGTTCGACGAACCCACAGTACGTGTTCTTCCAGCCCGACTTGACGCTTCGCTAGTCGATATTCTCGCCACTCG
TGCGCTTGAATGTCCAAACGCTCGGGTGGCCCGGCGTTAACATGGGAGCCGTACTCTTCGCTGTCGATCATGTTCTTGGTCTTGATCAGTGGGATTTGGA
CTTCGTGCGGTAATTGCGCCGCGCCGTGGAACAGGTCCAACCGGATCCCGGCTGGGATCATAAAGTCGGTCCCGAGTACCACGTCGACGCCTGCACTATG
CGCCATTACCCACATCTCAAACTCGTACACCATCTCCCATCCGAGCGTAATCTTGACGCACGCTCGTCGCGTCGTAGACACCTTGCCTTCGTTAATTCCT
TGAATGTCAATGCGGCGTCCGTGATCGGGTACATCTCGGAGTCACAACTTCTTAGCAAAGGCGTCAGTGATCACACTAA