Description :
From Genome Similarity Track
Location :
Scaffold_163:502- 1776
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_163-snap-gene-0.13Myosin

Sequence
1274 bases(100 bases per row)
ATTGACGCCGAATAGAACGGTCGTGAAGCTCATCATGCGCGATCACCATATCGGCGACGCAGGCGCTCTCGCGATCGCCAATATGCTGCGCGTGAACACG
ACGCTGGAGTACATTGATTTGTACGGCAACAACATCACGGATGATGGCGCAGAAGCGATTGCGAATGCCATTTTCGGCCACGAGTCGTTGACGTATCTCT
CGATGTGGAGCAACCAGATCGGTGACCGCGGCGCGTTTGCGCTGGCAGAGGCGCTCAAGTGCAACCAGGCGCTNNNNNNNNNNNNNNNNNNNNNNTTGGG
ACTTGTGCACAATCGGATCTCGGTGACTGGAGGTGAAGCACTTTTGCAGGCGCTCGACCTGAATATTCATCTTCAGACCTTGAATCTAGCAAAGAATCAT
CTTCCAGAGAACGTCATCTACAAGATTCGTGTCGCATTGGCCAGGAATCGGTACGATCTTTGTTGTAAATTGGTTGCATTTGCAAACGATATCTACGCAT
AACTCACTTGTGCTTGCTTGATGTCGTGACGATACTAGGCTGGAAGCCCCCAAGATGATCTCCGAGATGCAAAAAGATGATCAGGAGATGGCGCGACGGT
TCGCTGATATGCTGCTGGCAGACTCCGGAAGCGAGGCGAGCGGGTTCGAGAGCTGCTCGAGTGGGTACTTGAGCGTCTCGGGTGCTGACCAATTGGATCA
GCAAGAGTCGCTGGATTTGGATAGCGATGCGAGCGGGTACTGGGTGTAATGGCGCCTCTTGGATACAACTTGGAAAAAAGAGAACGAGTAAGTGGCTGGC
TGTACGAGTAAGTAAGTAAGTGCCGTATTGAGCGAATATAAATATGGTGGAGGTAGACGCTTTCTTTGTCCTATCACGTGATTTTTTCCCTCCTGAAGCA
AAATATTTAACTCTGTGATGACGACAACTCTGTACCCTGCAAAAAGATGCGCCATTGACTTACGTGGACACTCTGCCAACAATTCACGCACGGACATCCC
TACGCTCTAACAAAAATAACCATTTGTGCTGACTTCGTCTTCTTCTTCGTCATCGCTGCTCAGGAGGTCTTCATGGCATGCCAGATCAAGCTCTTGAAGA
AGGGAACGGACCGAGTTTGGCTGCAGCGCGGTACATTCAGGTGCCACGGAGCCCCAAGTATCGGCTTGCTCTTCCACCAATTTGCTAGCCATGACCATCT
CCCAGTTTAAAAGCTCATCGGAAGGAAGAGCACCGGGAAAAAGCAATTCCTTGAGTGACTCATTCCACCAGTCT