Description :
From Genome Similarity Track
Location :
Scaffold_60:50195- 55801
Transcript NameFunction/comments
Phyci_229271conserved unknown protein

Sequence
5606 bases(100 bases per row)
CCCCGGAGCGCTGTTTTTGTTACCGACACGTATCACCGTTGCCTTCTCGAGAATGGGATTCTGCACAACTTGGTCTCGCACGACAATCTCCCGGCCGAGT
GCAAGCCACGGAAACTGGATCCAGACCCACCTCTGGTAGAAGAAGAAGCAATTTCTAAAGGATTCCTTGTCTTTGATAGTAGAGCTTAATGTGGTGATGG
TTGATGCATTCGCTGTCGGCGGAAAATTATCTAGCGCTGTCAGCAGTGCAGATGACGCAGTTGATAGTGTACTTTCCATGCTGGAGATACCACCCAAAGT
TGAAGAACCAGTTGTTGATACTGAAGACAGCGCAGCTACAGAGGTGGTGCCTACAGCTGAGTTGCCGACCGTCTGAGCGTGTGGTAAATTTTCAACAAAC
AGGAACCCATCCAAATAAAGCCTCTTCAGATCGAAAGGTGCATGTACGAACTGGGGCAACGGGCGCTGATACGACACACAGAATTCATACATGAAGCGAG
TGATAAGTTGCACAATCGCTGTAAAATTCTTCGTGCTGGGGCGTGCACTGTGATACCAGTCTGTGATGCTCTTTCCGTACTCTTTTACAATATCGAACGG
CATAACATAGACTGGTGGGTCAGACGAACGCTTTGCAGCGCCATAATTGAGCAATGGACCATCGGTAAGGACCTTCCAGTACCCATAAAGCTCCGCTTTG
TAGTTGGCTGTGTACAATAGTTGAAACATGGGCAGGTTCACAAGTACTTGACGCAAAGCATCCCACTGGTAACAGCGCTTGAGATGCCATGGTAGTTCTT
CGACACGGCGGAAAGTAGTAGGGTGAATGCGAAAGAAACGAATGAGCCACTGGTGATATTGCTGCTCAGCGCGCTCGCTGCCGATGTATCGCCACCAAAT
GACGTCGCGCAGTATGTCTTTGCACAATGGTAACACCACTACCTCTTGGACGAAAAGCACACTCAGCGTGCGTAGCGCGCGTAAGAGAGCTTGCCACTCG
TCCTCTGAAAAAGCTGTGAGAAGCTGCTGCCCCATGCTTGATTTTCCGGCTGGGTGATCAAATGCTGTACCTTCATCATCTCGGTTATCTCGATGGCGAT
GAATACCTCGTGACTCGGTTACTATGGCATTGAGAATGAAACGCAGTTCATTCAACAGTAATCCGTGACGACTGACATAGAGAAGGCACAGTGCTCGCCC
AAGTAGTTCCCCAAGTGGCGCCACAGTGCGTCCGCCCGTCAGATAGTCTGGCCTATTACCAAGTTTGTTGAGAGCTCCTTGCTTACTCCCTCTGGGCTCT
GTAGGAAATCGTTTCAACTTGTGGTGCGCAGCTTCCAGCATCGAGCTGACTGCAGAAGAGTTCTTGGTAGACGAAAACGATTCATGAGATTGCGAAGCTG
GACCACTATCCACCGTTGACTGTACTCGAGACCCGTCGGCGCGTGCCATATTCACGAACAGTTCTTTGGTCTCGTGCACACTTTTCATTCGTTTCATCTC
GTTTGTCCCCGAAGGCGAGGCGCGGCCATCATCTTCACGTGGGCGAAAAGCAAGAGGGCGCAGAGAGTCATTGCTCTCACGAACTGCAGCCTCTGCAGCA
GCACGTGCTATCTCAATTCTTGTCCGACTGTCGTTGTGGTGCAGTGAATATCGGCGACCAGAAATCTGGGCAAGCTGGGAGTCCGCCCCGGACGTTTTTC
GAATGGAAGGTGAGCTCGCGATGGATGCTGGATCTCCCGCAGGACTACGACTGGCACCGTCACCATCGTACTCTAACAAGAATTGCATAGCGTCGTCTGT
CGAGAGTTGGTCAGGTGTGTAGCCAGCTTCCATGCTGCGAAGTATCGACTCCAGCAACTGGCCTACAGTTTCAGCGGCAAGCCAGCTTTCGAAGACCGTG
TGAATGTTAAACCCCTCCTTCACTGCCCAGAGCATGCCTACGAGAAATTTTTTCAAAAAGTGCGGGCTCGCACTCATTGCCACACCAACGATGGCATTCT
GTTGAATTTCAAAGAGCTGAAGCCCCATTTTTCTTGGAGATCCGTCATCGTCCTGGTCGCTGTCCGAATTTTTAGTAATGAACTGTTGAACGATGCGTCG
TCGATCCTCTTCGACCAGTGGGAGAACATGGATGAGCTTCCAATTGCGACGACCGGCCTCAACTTTAATCCTTTCGATCATTTGAGCACTGAGACTGGTC
TTTTCGTAGTAATCGCCTCCAACCCCGCACTCATTGTGCTCCCCTTCATCACCACGCGGCACTGTGTGAGCAGGTGAACCTGGCCCATTGTAGTTAACTA
AAACGTGGGATAACTTAGCAGTGGGGTAATTGAGAGTCCCTGAAAAGATAATGCGAACGTTGGGCGGAAAGGATAGCGGGACCCACTTCAAGATGCTCTC
ACCGTTGTTTGTATGCAGTCGGTGTAACCCATCGACCACAATGATAACACGACCTTTCTTGGAGGCAGACTCCAAGAATCGGGGAAATTGCCAACTTAGA
CGCTCTTCCACATCCGGGATCTCTTTGGTGAGCTCGAAGTACTCCTTGATCTCTCGCAGAATGCGCTCGAGCAGGTTCGATACAGAGCAGGATTGCCGTG
AACACCCCACCACATGTGCGAAGATGAACTCGGGATACGAGGACTGCCAGTTCTGGAACATTTTCTTTCGACGCACAACCCAGTTCGCCAGGAAAGCACT
CTTCCCCATTCCACTCTCCCCCAGCAGAATCACGGGGCCTTTAGGTGTATGCATCGAGTCGACGTCGCAGAATTCGTCGAGCTCACGCGTCAGTCGGGGG
TCTTCATGGTACACGAAGTCGCCTGTTTTGAGTCGCAGCCGCATGAAGCCATGGTGGAAGGCACTCTCCAAATATGACACGGAGTCCCAGCATTCGCTGT
TGTTGATGGGTGCTGTTGCGCTAGCCCCATTGATTGCTGCGCTTCTTCTCCGATCCATCGCTTACAACGTGCAGAGGAAACGTGGAGCTTCTAACGACTG
GCGTTCACGATAAATTGTGGTTATCGATTTTTATAGCATTCGGAAACGGATTCGATTGAGGCGAGGTAACTACAGAGGCAGGTATCTGAATGTACATTTC
TTTCGTTGGTGGAGCAAAAATCTACAACGACTCTAGTGTAAACTATTGCGTGACAAGTTGTACCTGTCGTATCTTTGGTTATCAGTATTGCCATGCCAGG
GGCTTACAAAACAGCGTAGGCGTACCCATCTTCCGAGACGATCCGCACTTCGTCGTGTAAGTTCTCCGAAGTCGATGCCCCGGCAGCAGTTTGGCTCATC
TTAGACGATTCACGCTGGGCCATTTTCTGGTCGTTACCAAAGTTGAGACACAATCTCGCAACACTGTCGTGGCCGTGCGACCTGGCAAGTGCCACAACAT
CCAGTCCTCGAGTCGTTTTGTGATGAATGCTACCTCCGTGACTCAGGAGCAATTTACACATGGGCAGACTACCCGATTGAGCAGCGAGGTGCAGCGGAGT
CTTGCCGTTGTACGTATTCTTGGTGTTCACGAACGCGTCGAACTCAAGTAAGAGTTGGAGAACAGGTAGGGCCTGGCATGCAACGGCCACGTGCACAGCA
GACACATTATCGGTGTTGCACAGGTTCACGTTCGCGCCATACTCGACGAGCATTTCCACAACTTCAAGATCTCCTCGTTGTACGGCAGAAAGCAGGGGCG
AGACACCGCTGGAGTCCGTGACATTCGTGTCAGCTCCGTGAGTGAGCAACAGCGCAACAATACTCTGATGTCCACAGCGACATGCTGCATGAAGGCTTGT
CAAACCATCCTCCATCACCGCATTTGGGTTGGTTCCGCGGTACAAAATGGATTCGACTGCGTATGCATGGCCAATTTGGCTAGCCACGTACAGCGCCAGC
TCCCATTGACGATCTTCATTCCATCCTTCAAGTGGTCCAGTAGAGCTTCCGAGAGCCCGCGAGTCCAGCAATAGGTGGTCCCTAAATTCCTCAAGGAACG
AACGCATCGAAGATACATCGTTGCTGGGTAGGTGCAGCTTGGGAAGCCCTGGCAACAACGTCTGCGGTGCCTTGGTATGAGAGGTGCTTGAACTGCTACG
AGTTGTCATGGTAGGATTGCGAGCTAGGAAAGCAGTATGGCGTCGGATGTCAATTCCACGATAGTATCGAGATCTGCGGCCAGTCAATTGCAGTTTCGTC
GAGTTCTTGGACGATGAGCTAGCAGGAGTCGGGGGTGTCATGTATTTGGCCGAAGTCTGCTTTTTAACCGTGTGGTCTCCCTTTCTGTCATTTGGATTCC
CCAAAAAAGCAGGGAGATCTTGTAGTTCATGAAGCTCGAAAACGGAGTCGTCGTTTTGGTGGTTGCTCAAGTTCGAGTCGTTTTTTCGCAGATAGTACTC
GACTCCACTTCCATACAAAGATCTCTCTTCTGCAGAGGGAGATCTCACCCTGCGTTCCTTGTCAATATTCCATGTGCTGCTGCTGCTAGTCACACTTCGA
CTACTGCTCGAGAAAGAAGTCGTGCTGTCGCTTGCTACACTTCCTGAGCTGCTGGATCGGCTGGTACTGGTGGGCTTGGGGACTGTGGGCAGCCGCAGCG
TTGTGCGTGATGCTAGTTGGTACTTTTCCTCGAAGCCGAAAAATATGTTCAGGGTCATCAGCACTTGGCAGTTCGCCAACGAGTCGATACTTTGAAGGAA
TGGCCGAGGAAAGGTGTCAAAGAGGCCTCGCACAGTGGTGATGAAGAGCTCCAACCCCCGGCGCCGGTTCTCCAATACGGCTGGCGTGTTGCGCTTGATC
AGGAATTTCGACGGGAACGGATAGCTCCTAAGGAAGTGGTGGAAGCTACGGAACGTGCAGTTCCAGTTGCGGCAGCGGCAAGACGAGGACTCGCCACCAG
AGCTCGGTACGGAGTGGAAAGTATTTGCCAGCGATCGATTCGACGCGTGTCCCGAGTGAGTCGTCTCAGCGCTGTTGGAACGTAGCAACATTGCCGTCGC
AGGTGTTTTAGTAGCACGGATCAGGTCTCTCCAAAGCTTGCGAAACTGCGAGTACGAGCGCTTGGCGGTCACGCGAACCCCCGACGTGTTGCCGGCCATG
CTGTGGTTTTCATCATCGTCGTCATTTTCAAGCAAAAACTGGGAGCTGGTGCTCGTGATGCTGGACCAGTTGCGCGCCAGCTCTTCCTGGCGAAGGGCGC
GCTCGTGCAGCTGGATGGCGAAAACTTGCTTCCCCGCGCGGACCTCGTAGAACGGGACGGCGACCTCGTGCGTCTGTAGCCAGCTCATGGTGCGAGTCGA
GTCGAGGCTGGTAAGTACCCTAGCGGAGCAAAGGGTGAATTCGTTTTTGAGCACGGCAACCGCCGAACCCAGTCGAGCACATCGGTGCTTGTACAACGCT
CCAACGCACGCTGCGTCTGTCGTAATGGGGCCGGTCGGCACGTTCAGACGCTTATCAGTCCGTCTTAGCTGATCCCGTCTAGTTCATTCTCAGGATGTTC
GGCGTTACGGGTGTCTGGCTTTCGATCGTTTCAATTAGCAGCCCCCTTCTTCTACAAAATCGGTAGACTAATGGTGACCCCGTCGTAGTCGGCGCTCAAT
AATGAG