Description :
From Genome Similarity Track
Location :
Scaffold_222:50195- 53399
Transcript NameFunction/comments
Hyaar_Emoy2812870hypothetical protein

Sequence
3204 bases(100 bases per row)
TTCATTAACACTTCAAGAATTACTGACACTGACGGCTCGCGGAAGACTGACGATATACCCGTCCATGGCGAGTTTTTCGGCCAGACCGCACATCATTATC
TTTCCCACTTCAAATTCGCCCTCGTCAAGTTTACCTTCCCAGCTACCTTCTGGTAATGAGATTCGTCGAAGTCGAAGCGATCCCCTTCTCCACCACCAGC
TCATCTTTCGGGTGTTCTGGGAAGATCCTTAGCCGTTTCAACTTCGGCAGATGGACGATTGGAAACAGTCGGTAGGGGGTGCCGACAATTTTTAGCCTTA
CTGCATGATCGCCACACATCTCTACCACCCGAAACGGCCCATGCCACATATGTGCCAGCTTCTTCGCGTACCCTTCTTCAACCAATCCAGATACAGCAAC
ACCTGCAAAACTACTTCAATCCCATATTAGTCTATATCATCATTATGTTGATCAACTCGTTCTTGGATTGCGGCTTTAAATCGGTCATTGACTTCCGCGC
AAGCTCGTTGATATTGCCTCTGTAAACGTTATATCTACATTTTTGGATCGCGGTCTCGCGCTCCAGTGTTTCCCACTGCTAGTGTAGTCTCTATTGTAGA
TCGCGGGTCCCACCCATGAACCAGATAAAAAGTGATTTCTCCTTGAATTCGATTATGAGCCGTGTTGATTGCAAAAGTGAGGCGTTTCGCGTACTCGTCC
CAATCCGATTGATTGACATCATCGAAGTACATCTTGAGTGAACGGGTCAGGGTTAGTACCATACGCTCTGCCTTTCCGTTCGCCTGTGGTCGATATGCCA
TATTAGCTCGTTTTCTCTGTCCCATGATTCGGTTGAATGCCCGAAAGAAAGCGGGCATGAATCCTGGTCCTCGATTATGTCTTATGGCTTCATCGCCCCG
AAATGTCGGGATACACATTCTTCATAATTCCCAGCAATCGTCTGCGACGTCCGGGATGAGCTAGCTTTCGCGATGACATACCCTGAGTAGAGATCGATCC
AAATGAGTAGTTCCGTATCCCCTTTGAATGACTTGGGCAGCAACGGAATGTGATCCATAGCGACAGTCTGGAAAGGATAAGTCGCTTGCAGATTACTGGA
CGAATTTCCTTGGATCGCCGGACACCCTTTTCCTGTATCACAGTCCGTACACTGGTCCACGCAGCGTTATACAGCCCAATATAACCCTTTCCAGTGGAAT
CGCGATCTGATCCGCTGGTAAGTCCTGCTGATCCCCTGATGGTCTTCTTCTAGACTGGCGTGGTAATGGTGCAAGAAGTCTTGTTGTAATGTCTCCTGTA
TTACCAGTCTCACCAACCCGTCGCGATCCTCTAGATTCTTTTTTTTCGCAATCGGACATAGGAATAATAGATCGGTCTCATCAATCTCGTAATCTGGACC
ATTCTTGGGGCACGTCTTCGCTTCTTCTCTACTCAGGATGGATACATTACCCATTTTTTACTTCTTCAGGTTGACGATCCAACGTCCTCCATATTGACCT
TGACGAATTCGTTCACTTCTGATCCTCTGCACCAATTCTTCCTGTAAGTTCTCAGGCGGATGACGTTTCCGCTGCACCGACCTCGTAATTGCAGTAATCC
TAGCTACCGGGTCGGCCTGTCTTGGCTTCAGCAATTCGTCCAAGCGATTCAGAGTAACCACATTTTGGTGATCTTCTTCTTTTGCAATCACAGTCCCCTT
TTTCTTTTGTCACGCAGCACTGGCAAGACGATCTGCGCTTTGACTCCAATCCCGCGTCATATGCAGGAACTCATGGATCGGCCAGGATCGCAATTTCTCT
AGCGCCCTGTGTCGCAAAAGTTGAAGGCCTGGTGTTTTACAGTCGATCTCGCCTCGCACCTGTCGGATCACCAAGTTGGAGTCGCCGCAGATAATGACCT
GGCCCCGCTCCAGATCGGCAGGCAAGTAGAAGCATAACAACAGGCCAATATACTCGGCCTCATTTACCGTCCGATTGGTAGCATACCTGGATTCCTTCGA
AAAGATCGTCCATTCTGGGAGCTTCCATATTACTGCGCTGTATGCACCCCCTTTTTCTTGATCCTTGCCGATCCATCGAAACTGGCTACTATCAGATTCT
CGCCCCGTTCTACTGTCGACGGAGGCATAGTTATCTTATACCATTAATATTTTTGTGGGGCGATCGCGATCAACATCTCTTCAATCTTCTCTCGCGGGGT
TATACTTGCTGCCAAGGCTCCCAATATCTCGTCATCTCCTTTTTCACATTTCTTCTCCTCCATAGTCCAGTTCGACAACTAAGCAGCTCAGCGTCGTAAG
CTTCCGCTGATACCGCTAGACCTCACCGACCATGCCAATGTTGAGTGTCGTGTACGTACCGGTTCTTCCTTTGATGCCAACATAGTTTATTACACGCCCA
AGATACGAAGCAACGCATGTACTTCCTTCTCCACCGTCCCATAGTTGAGTGCGCTCACCTTCAGCGCTCGACTGGTGAAGTAACTGTCCAATACAAGCCA
TCATATTCTTGGATCAGGGCCTCTGAAACAGATTACTTGCAAGCGTAAACCACAATCACTGGAGGGCGATCTGGGTCGAAATGTCGTAACGTCGGAGTTG
TAGCGATGTTTGCTTAGTGAAATTCATTGTAGCCTCTTTCCATCTACTGTTGCTTTCGTCTCAGACCGCTCTTCTTTATCCATGCACTGAAACCGACCGA
TCTCATGGAAACCCGCTTCTCGTGATTCATACAAACAGCAGCATAGATTTCTTAGTCTTCAATGAGACGGCTGTAGTAGTTCAGACTTCCTAGAAAGGAT
TGCATTGCCCGTAACATGCTCGGAAACGGGATGTTGACCAACGATTCCAAGTCCTCGGCCGAGACCTGATGTTCTAAATAATCGACCTTCCGACAAGCCC
AAAAAGCACTTTGGAAGACTGATCGACTAGTTACACTTGTTACACGTTCCTAGCACTCTTTCCACCTTCTCGTATAGAGAATCCCACGATCTTGCCAGTG
TAAGGATATCGTCGATGTAGGATCTCCGCCCAGTATGGATGGTTGCCGATCTGTCTCCCGTTCACCTTCTTTGACCACGTCGATCTTCCCTCCTCGAGGC
AAGCCTTTGCCGATCTTAAGGTATCCATAAAGTGCATTGTCAACTGGACGTTGGTAAATCTAGGCGCATTCTGTAAATCGGATGGCATCCGAAGCCATTC
GTAC