Description :
From Genome Similarity Track
Location :
scaffold_823:5017- 6175
Transcript NameFunction/comments
Pl_102253sterol 3-beta-glucosyltransferase, putative

Sequence
1158 bases(100 bases per row)
CTCTGCTGCTCTGTCTCGTGGTGCGCAGGGACTCGTCCTCACGTCTCTTGGCCTGTTCCTGCAGCTCTGAGATATCGTACTTCTCGTCGTCGTCATCGAA
GTCCATGTGGATGTGTCCGTCACTGTCGAAGGCCGCTGCCGCCTGTACCACATCCGCGAAGGACGTGAGCTTACCAATATCCATGGACTGACGTCTTCTC
TCCTCTGCGAGAGTCTGTACTGCACGCTGGAATGCCTCCTTCCATCGCTGTAGGTGGGTCAATAACATGGCTACATTAGTCAGCAACTATGGTGACCATC
ACTCTTGTCCGCACTGCGTTACCTTGGGCTTCCGGTCGTCGACGGGCGATTGGGGCTTCTGCTCCTCATCTTTTGCTGCTTCGTGCGTCTCCTGCATCAC
CTTCGCCTCGGCCTTGGGCGTATTCTCCGTCTGTGTGGCCTCCATGCAGCTCACGAGCGACCGCCTTCCTGCTGCTTGTGCTTCACGACGCAAAATGCGG
AATTAGTTGTCCCGCACATTTTGCTCAGCATCTAAGAATTTATGCTGATCTGATTCGAAATTTTTCAATCACTTGGATGTTGTATGGACATAGAACTTTC
TCTTATATCCTGAGATAGACGATATGAAATGGGTACACTCAGATTTATCGATTTGAAAAGCGGGATTACTGACAGTGTGCATGGAGCAATCCACTTGGTC
CGTGCATCGCTCGTAATCTGCGCGGGAAACTCGTGTCGGATTTTGCTGGCGGAAAAAGGCTCGACGAGGCGACTCGACTGAGTCTTGAGGAGCTGTTGTC
CGCCTAAACCTAAAGACGGAGGCGCAGTACATGTATTACGCGACCCAGGCGACAACATGGGGCCATTGTGCGAGCGTGAACGGATCCTGAGCGGGGCCGC
AGCAGTAATGGTTGCCGTGGAGATTTTTGGTAGTCTCGGGATCTGCTAGCACGCATTTCATTCTTACTAACGAGCCGCTTCGTTGTTAGGACGATTGATG
ATTGCCTCCAAGCAATGGCATTGGTGTCTCTTGATACCACCCAGATTTGGATATTGAGCAATAAAGACTGCTGACCATGTCGTTATGGCCCGTCGAGTGA
AGTCTTCACCTTTTGCTCTTGCAGGTCAGCAAGTCAAAGGACTGGGATTCGTGTACAG