Description :
From Genome Similarity Track
Location :
Scaffold_134:50162- 58275
Transcript NameFunction/comments
Phypl_g3919conserved hypothetical protein
Phypl_g3920maleylacetoacetate isomerase
Phypl_g3921conserved hypothetical protein
Phypl_g3922hypothetical protein PHYSODRAFT_325073

Sequence
8113 bases(100 bases per row)
ATGTCGATTTTGCTTGAGTACACAGCGAGAGACGCGCCACTGATTACGGTTGCACCTGTCAGAAGCGATCGCAAAATACGAAATCATTAGCGTCCTATGC
GCATTCCAAAATGTAAGCATAGCAATTACACAACACATACCAACCACGGACACAGCTTCGCCCTGAACATTGGTTTTGCCCTTGTTCTCGTTGCCTATGA
TAATCtcgtctgcttcttctccgacCACCAGCGTTTCCATCGCATCCACGACGACAGACTTTCCCGTCAATGAAACTTCAGATGCTGCAGAAAACGAAGT
TCATACACGTAGTGTGAGATACAATGCACCAAACCAATAACAAAAGACAAGAACTAACCTTCGGAGCCGATGGTAATGTTGGAACTGAAAAGTTCGAGCT
GGCTTCCGGTAGGCGGGGCGACGGTAGCATTTGCACCAGGCCCACCAATAGTCACGTGGTTCGCCTCGATAGATGCGATACTTGTCTTTCCTTTAGCACC
AACGCGAAACCTTGGAGGGTTCGCTCTGACAGCAACGTCCGTAATAGACAGCAAGGAGCCGGTAGTCGAGCTGCCGTTGAAATGCACTAGACCCGAAATG
GTGGTGATAGCTTCGCGGTTGAGCGTATTAATCGCAACTGAGTGAGATGCCTCCAGCTCAATCGCCGATGACGCCACCTTGGTCATCTGCTCCGGTGTGT
CAGCGTCTCCAACAAGAATCGATGAAGCACTTCCACCAATTACAGCACTTTCCGTTGCATCAACCGTGACAGTAGTACCCTCCACTTTGACCGTCGACAA
GCCGGCCTTGCCCACTTGAACTGACGGTGAGGATGCACCTAAACGGACATCATTCGAGTTGACGTGGAGTTCTGATAAGCTCATAGCTCGGTTATCAAGA
GTGATCCGTTGCGCTGATACGTTGAATCGGCCGCCTCCCACCTTAACTTGGGTGGTGTCATTTACGCCACCAGAATGCTGGTTGAATGACACAAGGCCGT
GAATGTTGACCTCGTGTGTCGAACTGTGGCTGCCAATCTccgtcagcgacgacgctgtcTGGTGTAGCCCAGCGTTAATAGTGATGGATCCGTACTCCGA
TTCCGATTCGGTTGCTTGCCCTCCGACTAGCGTCACGTCACCACCGATATTCAGCCCACTACCACCCACGATGCTGATATCTCCACCTTCCTTCTGCGTC
GAAGACGTTTGGCCGACCACCTCCAGCGTCACACTCTCGCTTTCTTCTGCGCTATCAGCTGCTTCTAACGCTCGTGCGCCATCGCCTCCGTCACTGTCAC
TTACAGAGGCATCGGGTACCGAGATCCGTACTTTTCCGCTCGTAGAAGTACCCACGAAAACTGTACTCGTATCGAGATGAAGAGCCTCGGATGAAGACAA
ACTTGACGAGTTGCCATCATGCTTTAGCGTCAACCCACTGCCAATGCTGATGAGCCCCCGTGTGCCATCCAACGTAATACCAGTTGCTGTAGGCTCATCC
GAGTTCGTGTTGGCCACTGTCACTGTTCCGACTGGGTCGACAAAAAGCAGTGGCTTGCCCCCGGCGCTCGTGACGACTGCTCCTGCTTTGGACACAAGAT
TTAAGTCACCCTGCTCCTTCACACCGCCAGAACTGTTGGCAGCTGTGGTCATCACCGTGCCGTCATCAAATACAACCCCTTTCCTGGCGCTCAAATAATC
TGCCTCGACCATGGGCGCTATCGCAACACCAAACGAAAAACAATGTCAGCCACCACCACATAGACTTCCAAACTTCCGCCATATTACCTTCCACCCTGTT
CGTGAACGTCGACGTGCCGTTGGAAAAGAAAGTGACGCCATAAAACGTCTGTTGGTCCTCCGATTCGAGCGCCCGTCGCCCGATCTTCAGCTCTCCATCA
TCGAAAGTAATCATGCCTTCCGAGTACACCGAGTTCGAGTATCCTACCACACCATTCGCACAAAAAGGTAAAATAAACGCGTCAGACGCCAACCTTCGAC
GCTCCATCCTCCCTCCAGGTGCACCGCCTCCGTACCGCTCTTCAAAAAGATCTGtgcgtcgtcctccgccaccaccgtgaACCTGTTATCCACCGTCGTC
CCGAAGAGGTCGTTCTGATGGGACTCAAAGAAGTCCGTCTGCGTCAGGTAAATCGTGATGCAGCTCATCAACGcgaagctcagcagcgtgagcaccCCAA
TGGCCGTCCAGAACACGTCGCGGTCTTCTCGCTTCCGTCTCCGGAGCGTGATTCTCTGCAGAATGCCCCCGCTGGTTCTGTAGCGGAAGCTGCGGGCGTC
CGCGTCGGAATGGAAGAAGCCTCGCCGCCCGCGCAGCCGtcgcagccgctgcacgcCGATGCCGGCCATGCGTCTGGCTcggtcgccgtcctcctcgtcc
tcgtccagcatcaGGTGGTCGCCGCGCAGGTCGTCGCCCGGGGATTCCATGGGGATGGCCTGGCGTCCGCGCCGGTACGCGTGCTCCTCGCCCTCGGTGG
ACAGCGCGTCATCGTCCGGGTCCGCACCCTCGTCGccctcttcgtcctcctcgctgcggGTCGTCGcgtcgttgccgtcgtcgtagtAGCCCCGGGCGTC
TGCTCCGTCCAGCGTCAGTGCGCGCCGCCCGCGGCCTTCGAAGAGCGCGGGGCCGCCGTTGCCCACGTCGATCACCTCGTGGTCCTTGGGGGACGAGGCC
ATCGGTCACTTGAGGGGATAAAGTGACGATGCGAAGAGTCGGTGGCAGTAGGCATCAAAGGTCTAGTGCGACCGACGCATGATGTGGTGGAACACCAAAT
TCCGCCGTTGGCGTCTCATCTGCATGATTATGCGTTTAGTTAAATTACAGAAAACGCCGCATGTTGCAGCTTCACCCCACTTCACTTTGGCTTTTGGTGA
CACTGACAATGGCAGCTTCCAAGGAGGAGAGCTACGTCTTGTACTCGtactggcgcagcagctgctcgtggcgcgTGCGCATATCGCTGGAGTGGAAGGG
CGTCCCGTTCGAGTACCGCGCCGTGCACCTGCtgaacggcggcggcgagcacTTGCAGGACGCGTACACGGCGCTCAACCCGAACCAGCGCCTGCcgacg
ctcgtggtggacgGCCGCGCGCTGCCGCAGTCCGGCGCCATtctcgagttcctggaggagacgcacccggagaagccgctgctgcccagcgACCCGCTCG
CCCGCGCCCAGGTGCGCAACCTGTGCGCCATCGTCGGCTGCGACATCCAGCCCATCCAGAACCTCATGGTGCAGGTCAAGGCGACGGAGGACGTTACGGA
GGCGCAGCGaggcgccaagaagcaggcgtGGAGCAGGTTCTGGATCGAGCGAGGCTTTGAAGCTCTGGAGCGAGAGCTCGTCAAGACGGCGGGCGCGTAC
TGCTTCGGGGACGACGTCACGCTCGCGGATCTGTATCTGCAGCCGCAGGTGTACAACGCCAACCGGGTCGGTGTAGACATGACCAAGTACCCGGCCATTG
CGCGCATTTCCGCGGCACTGGAAGCTGTGCCGGCTTTCCAGAAGGCGCATCCGTCCCAACAACCTGATGCAGTCAACTAGCCTGGcaaggagacgaagac
ggctAGTGATGGTCTGTCCAGTCCGGTTTTCTGGCTGACAAGGCGTTAATTGACACCCTTTGTGCGCGTCTAGATGTTATCTATTGAGTTTGTTTGAAGG
AGCGgaccttctccttgacgGCTTTCAGATGCTTCTTGATGGTCcggacttgctgcttgtcCACGTCGCTTCGAGCtttctccagcgcgagcgcgacttt
catctccttcttcagtTTCACGTACTGTTCCTGCGATAAGTTGTCTCCAAAGGGCGAGCTCAACAGTACATCGGCATCGACGCTGTCTCGGAGGGTGCGG
AGTGTGTTCGCGAAGTCGTGGATGCAGCGCTGACGACGGTAATTGAACCAGGGCTCGAAATGAGGGCCCTTCACGAACGACGTGTACAGTGCCTTCCact
tgcccttcttgatCTGCGGAGGAAGCTTTCGTGGGTTGATACTTGAAAGTAACCCCGGCAGCGTGAAAGGCTTCATGTAGTCTTCAGCACTCATATACAA
GTTTGACCGCCTCCCACTTGCTTTCCAAATACCGAAGTACTGCTCAAACGGGTGTAAGAAGTCCTTCGTGAGCTTTCGGAAGTGCTGTGTGGTCAAACAA
GCAACGATGGGTTAGATGCCAGAAGTGCACAACAATTATGGCTCAGCCCATACCTTTCGAAGAACTGCATTGTTGATCGTGACGTATggctcttcttcat
ggctGGTAGTCTGGATGATGTGAACCTCCGGAGGAGAaacgagctggtgaagaaCTGTGGAGTCGGGGACCGTATAGCGGGGGCAACGCCTCAAAAGCTG
AGATTACAGAAACGAACCGTCAGTGCATCGAAGCATATAGAGAGAGCAACTTTCCATCGCTTACCATGGGCCGATGGCTGTTTTCGAAATCATCCAGCTC
TACACTCTTCTGAATCCAGAGACCAATAGTGCCTGTTTCCTCCGCCTCGACGTGTTccgctccagcaacgcctgCATTACGCAAAGATCTACTGGTGAAA
CATTATACGTTTAAAGCGACCAAAGCCATGAAGTTCTTCAACCTTTTCCGTGCTGTGCTTTAGCGCTCGGAGGTTCTAGGAACGGAAAGATCAGAGCATT
TGGCCAGTGGCTCAGTGACTACACAAAAGTACAAGAGTTAGTTTGTCTCTGCAAACAGCTCATATATGCAAGttcaagtacatgtaccttCATAAAGAAC
GGGTTTGTGGTTCCGATGACAGTCACATCTTTCGGGTTGCTGACGCCATGGTTTTGTTTGCTTGCGAGCGTCTACATATTGAAACATCATGGCAGGTCGT
CAGAATTCCATAATAAAAACCCTTTTGTGTACTTGATGCAGAACTTACATCAAAGTCGGCTTCATAGACCGTAAAGTATGGTCGACAGTCTCCTTGGAAC
TGGAGTGGAGCAATCAAACTGGCAGCATGCAGCTGGACATTAGATTGCGTTGCTTGAAATTCTTTAATGAGGGGAAGCCAAACCTGGTAAATGCAAGCGC
AGCTTGACTGCACGTTCTTGCATGAGGAGATAAAATAAGAAAGCTCTCTCCGGTAATCGCGAGCTGCCACAGCAGCCACAACGATTCTTCAAGCCCCACA
AAACTGGAGTACAGCCCAATGTTCTGTTGGCAGAATtagcacacacacacacacaatGAGAAATCGTGATCAGGGACTTGTATGAAATCCATGCGTACCT
CAAACGGAGTCGATTGATGAGACCGCTTTGAGAGCAGAAGATCACCGAAAGACGGTGACGGTGGGTGTTGCCTCCGTGACACCACGAAATTACCTCCTTT
CACCAACACAGTCGCCTCCGtatcttcgtcttcgtcttcatccacaGCATTGAAATCCGGCACATCTATGGCATCGTCGTCTCCCTCGACAATAAAATGC
GAGTGCAGGGGTGAGTCTGCGTCGGACTCGTACGTTGTATCCAGATACTCGTAATTGAGCAGCTTCGGGATGATGCACGAGATGTACGTGCCAGCAAGTG
GCAGCACCACGGGGGTATCGTGCACGAGCTCAGGCCTGCAGTGCACAAAACCCCGTATCAAGTCAGCACCAACCTGTCGCTTCGATCTGCAATACACATA
TTAACTTACCACGACTTGATGTTGTTGTAGACCGCCGTTAAAACCTGCGGGCCGACCTTGAAGAAGAGCGGGCCGATCACccgcagcacgcggtcgtaCA
GATCCACGTACGGCTCCGAGctcaccagcaccagcgccttctggaAGTACCCGCGGGTGCGCGACTCGTCCTTCTGCTGGCGGAACAGCACGAACCCGAA
CAGGAGCTCGCGGCTGTTTGCAACACAGTTCCTCATTAGCCAGGACAAAGGCGGGAGGCATCAAGCGTTTAGAGGCTGCTACGGACTCGTCGGGCTCGTC
CCGGAAGCGCACGATGAACTGCGTGTCGCCCTCGGCCTGGTTGTTGCAGTGGGGCAGCGACAGGTACGCCAGACTCGTCTTGGCGGCCTCCGAGAGCCCA
CAGGTGGGCGGATGCAGCGAGTCCAGCTTCTGCCCAGAGTCGATGTCGAACACGACGGTCGCTAGCGCTCGCAGGCCGTAGGAGGAGGCGAGGTCCTGGG
GctcggcgctgtcgccgtcggTGGCGGCCTGCACCTCGGCATGCATCGCATCCATTATGGGTATTGTACCCCCTTGCAGTAACTAAGTACAGTGCCTGTT
TGTGATTGGCTCGTGAATAAGGCGAAAACTGCTTATTGGGCAATCTTTAGCGGGAAATGTTGGGCGAAGTGATTTGACCGTACAGATCCATGGTGAGAAc
ttcttgtacatgtattatagtTGACGACGCCCTTCATGGTGAAACCAGTCCCTTGAGCTTGGGATGTCAATGACTTGGTCTGGGTTCACCTCAGCTGGTT
CATCAAACGCGTGTACTTGTAACTTCAGCAGCCTGATGAACTCTTCGACCTTCCTCATACTGCATGCAGTCAACACGCATAAACCTGTAACCAGCAGCTA
CAAAGTCAAGTGGGCTACTGCAGACAAAGTATCAACGCGTCAGTGCCACTGTGCAAGGAACCTTGAGCAAAAGCACTGCTGTGAAGGACAGGTTGTGTCA
ACATTGTGCTTGCCCACCGAGTCGGCGACGATTGCAGTCAATTTCACGGacacgtgcagctcaagtggGCGACAATTTACTACAGTCTCCGACTACGAAC
TCACGCACggcattctgctgctgctgccgtcaAGAAGTTCCTGTCCACGGTACGGGGCATAATAGTAGATCGCTTGATGAAATTgggcacttcaacttgc
gtGTGATTGGCCCCCACATTGACACTAATTTACACATGTAGCCCGCATCAATTTGGCCAATCGTAGCCCAAATCGCCTCGCTTCTGTGGTTGAAACGCAT
CGCCATGCTTGGGAGACGCGGCCTGGGCGCCGCGCAGTCGAtgtggcgcagctcctgggcgTCCCCGGCGCAGCGCGCAGTGTCTACCAAGATCCTGTCC
CACCGCTCCACCATCCGCGACGCGCGGGGGCTGGGCAGCGGCTCGcgcgtggccgtgggcggcTGGGTCAAGTCTGTGCGCAAGCACAAGTCCGTGAGCT
TCGTGAACGTCAACGACGGCTCGTGtctgggcgagctgcagatCACGCTGCCGGCCCAGGAGGTGGAGGGGGGCGCGGCTCTGGGGGCTACGCTCAGCGA
CATCACGGtcggctccagcgtcttcgcgGAGGGGGAGCTCCGAGAGGTGCCCGGCGGCAAGCAGAGGCGATTGGAGCTGCATCCGAGCACGCTCGAGGTG
CTCGGTAAGTGCGACACGCAGATGTACccgctgcagaagaagtaCCAGTCGCTGGAGTTCCTGCGcgagcacctgcacctgcgtGCGCGCACCAACACGT
TCGGGGCCGTCACCCGCGTGCGCAACGCTCTCGGGTGAGATTGCGTTGGTGCGCTGACAGAGTTGCTGGGACGTCGATGATGCTGatgtttttgttgttg
ttgcgtgTTTCGGTCGTGTTTTGCAGCCAAGGACTCCACGTGTACTTCCAGGAGAACGATTTCTTGCACCTGCACAGTCCAATCTTGACCTCGAACGACT
GCGAAGGAGCCGGCGAGATGTTCCGTATCGCCAAGATCGGTCGGTGCCGTTGATGTCGCTGTTACTGGTGGTATTCGAGTGTGTAACTAACGGTTACTAC
GTGATTTCTTCGTGGTCATGCAGATGGAaaggacgaggagttctTTGGCACGCCGACGTACTTGACCGTGTCTGGTCAGCTGCACGCCGAGATGTACGCC
TGCGCGTTGAGCAAGGTGTACACCTTTGGGCCGACGTTCCGTGCCGAAAACAGCAACACCACGCGTCATTTGGCAGAGTTCTGGATGGTCGAGCCTGAGA
TGGCCTTCGCGGGGCTTGAGGAGTGCGTTGCCTCGGCCCAGGGTGCTGTCCAGCGTTCGTTGGCACATGCGCTGGATACTTGTGCCGATGACATTGCCTT
CTTCAACAAGAAC