Description :
From Genome Similarity Track
Location :
Scaffold_1052:5015- 9212
Transcript NameFunction/comments
Phyta_totarag11868conserved hypothetical protein
Phyta_totarag11869hypothetical protein PHYSODRAFT_498950
Phyta_totarag11870hypothetical protein PHYSODRAFT_560159

Sequence
4197 bases(100 bases per row)
tcgagcgccagaaggaggaggagaaccGCAAGGCCGAGTACGAGGCCAAGCTCGCCGACtacgaggaggagatggcCAAGATCCACCCGTACCAGGACGA
GATGGACCTTTGCGACGCTCTTGTGAGTTTCatggagaagacgtacgccaaggagctgaaggaggtggatgacaaggctgctgagactGCTGCCGCTCCC
GTTGAGCTCGACGGCATGAAGCCCATGCAGCGTAAGGAGGAGGACTTCATGAtgcttggtggcggcaagaagggcaagaagggGCGTCAAggcaagaagt
cgaagaagcccTCGAAGCTGGTCCTGCCGCTCGCGCAGATGGAGGCTTTCAGCACCATCGGCCTGCTTCCCCCGGCTGCTGTGGATGCCGTCTCGGAGTC
GCTGGCTGCcgtgaaggccaagaagctctcgtTCAACGAGCAGTCATCACGCTCGAAGGCCGAGAAGCCCGCGGAGGCTGCTGTTGAGGCTGCCGCAGCG
ACCAAGGTTGCGTCtcccaagaagaagagcaacaagaacaagaagttTAACGCCAGTGACAAGGATGCCTTCCCTTCGCTCGGCGGTGCCGCTGTCGAAC
TTCCGTCGTGGGGCCCGGGCATGCCTGCTCCCGTTGTCGCTGAGCCCGCTGTGGCGGCTGAGTTCGCTGATGCCGACGTCGTGACGGAGGACGAATAAGC
CTCCTTCCTCATAGGAGAGGGTCTAGCTCGAGAGTGGTGAAGACCTCTGGACAATCAACAGAACGGAACCAAGCAAGCTTAAAGGGAGAGAGGCGCTCGC
TTGTTGCCAAGGAAGAGCTTGTGACGTCTCTTGCTCTTTACTCTAGGGCGTGCCTGTTTCCACACCGGTAGCAATACAGTAGATACTTCCAACGTTTATC
GAGTATAGTCatttgtgctgctcatgcCATCGTTAGCGTTGCTGTCTGCTACGATCAGCTTCGGCAAAGAGTTGCTGCATCCGTTcattcttcagcttct
cgctgGACAGCATaatctgcagcaactggtCGGCCAATCGGCCTTTGAACAATTGCGTCTCCTCCATTTCAACTCGCGCCAGTTGAGCGTTACGCTGAAG
CCGCCGGgttcgctgcagcaacggaTGCAGACAGCGCTGGTTGTACGCCAATGAACGCTGTAGCAGGCGCAATTCTGCTGCCAATTGCGGCACCAAGATC
TCGAGGTGCTTTAAGTTCCGTTGGGCCTCCtcatcctcttcgtcatctgTGTCGTTGTCGCCCACATGAAGCTCGTCCCTGGCTCTTGTATCTGTGTAGC
TTGAAAGCAGAGGCAGACGCTCAAAGCAACTAGCCATACGTTCATTGATGAACTCCAGCGGATTGATCCACGTCGTGAAGCTTGATGCGGAAGAGCTTGT
CGTTGATGCTGTGGTAGCTTCTGTAATCGCAGTTGACATGAGCTTGCGGAACTTTGATCGTAAACGGTTCTTTATCTCGATGCGCTCGTTCAATTCAATC
GCAGCCTCAGACAACTCGTACGCGATGGCATAACGAACCGACATCGCCTGGGCCTGCGCTTTCTCGGCTGCCTCGATTTTGTGTTGAAGGAAAACCGTGT
CACTTGCAACATCAGTGTCGAAGCGCTGAAGCTTCGAGCGGATCAACTCTAGAGACTTTCGCTGTGCAGCGGCATCGCCCTCGTGCTCAAGTGTAGGGAA
CAGCATACGATGCTCTTCTGAAAGCGGTGTTTGCTGTAGCCGAAGGCGAAGATACTAAACACAAGTTTGACGGTGCATCGTGAAGAAAAAAAATAGTTCG
TTGGTCCTTCCCACAAAGCATCAGCACTTTTCATGACTGCTTTCTTACCTCAAGATGCCGCTCTTCCTCTAGTTGTTTTAGACTGGTGCGTGTCACTTTG
TATTTCAAAGCACGCTGTAGCAACAGCTCCGGGCTAAATGCTTCTTCCAGACCTAGTTTGGGGTTCTTGCGGAAAAACTCGCTGCACTGCTCCAGATCCT
GTCATAGCAAGAGCAAACATAATGTTACATTCATAGAAAAATGCTGGTTACCAAATATCGTGCTCTTATCTTACCATTGCGAGAAGCTTTGGTCGCAACT
CTGCGGTGATGGCGAGAGCAACTCGATAAACAGCTTTCCACCCATCCATTAAGAAGAGGTCCCAAACTCGGACAAGTGTCTGGGTGGTTAGTACACGAGC
AAATACTGTCACAAACCACTACGAAACAAGCGAAAACAATATCCTTGTCAGTTGCAATCTCGAAGTACGCAGTAATCGTGCCAGGAGATGCTCATGTCTG
AAAGTACCTGGGTGGCTAAGATACTGGAATGCATTCCAATCTGCCGAAAATGTCCCGATAGATCGTAGAAGTGAAGCttgagaagctgctggaatAAGTA
AATGCACTGCGACAGCCTGCGCACGAAAACAACATGAGCGATGAGCCCTTTGTAGCCTCAGCAACAACCTGTTGCAATAGGCAAATATATGACGAACCCT
GGCATCTTGTGCTTCCACAGATCTGCCAGCCCCTTGCGCCGGATTAACGAGAGGGTTAGCCAAAAGGCCACTTCTTGTACAGAGAGTCCGTCGAGATTCA
AGTCCGTAACCTCTCGGGTTTCTTTCGTCACGAGCAGAAGTGCAGCGACAACATAATTCATCCCCTTCAAACCACAACTAGAACCGTCAGTTTGTCACCA
GCACCAATCAGACGCATTCTAGCGCACCTGGCAGTATCCAATGTCATCTTCATGGACAGCGACCGCCTTCAGTACATTTCCGAGCAGGCGTCTACCATCA
TCTAACAAAGCAAAAGAGAGCACCAGCACTTTCATCAACAAAACCTTCTACCCTCCTTCCCTTCACCgcagagccagcagcactcacTAACCTTCATCAG
AGAAGAAGGGATTCGCAGGGAAAGTGCGCTCGATATCTCGACCGATTTCTCCTTCAACGCCTGTGGTCTCTAGCGCCGCCGTGTCCTCTAAACTCCCAAT
GCCAGCCAGCTACCAAATCCACTTCATCAGTCCACAACACTTCTTCAaccaagaaaaaaataagttcctctctctctccacCTTCAGATACAGTTTGCTG
CTACTCATTTGGTCCGGAATCTCCTGCATCAGCGTCGACACGTCCCCGGCCCGCAGCCAGTAGCTTCAACAAGAGCGTTGTACGTAACAACACAAAAAGT
GTCAACCTTTAGTCAACCACTAACGTTAGCAACTTGATTACTGCATCACACACCGGAATCTCAACTCAGCAGGGAATCCACCAAGCCGAACCGCCAGCCG
CCGCAACTTCCGCTGGTCCACTAGCGACCGTAAGTTCTTGTtgacggcagcgacggtgTCCACTGCGTCCACCTGCAAGTTTCAACACGCACAGACGTCA
ATGCATATAGAATTAAATGCCAGTCTGATGCAGAGATGATGGCGCAGTACCTGGACCCATTCGTGGCGGATGAGAACGCGCAAAACCTCCCCAAACTGCG
CATCAAGCGCCGCATCCGACGTGCTCATTTCGCCGCAAAATGATTGTCGCAATCAGGAGCCCGAAAATAGTCCACTGTACTGTGTGGGACACATATATCC
TTAGTTTCGGGATTTTCGAATGCGCATTGAGAGGTCATCATGAAGTCGAATGCAAGGGTTGTCATCGTACGCTACGAGCGCCGTTCACGATGCCAATGCG
TCGATAATAGTTGCTAAGTTATTGCGTTATTCTGCGTTGGAATTTTTCGCTGTTATTGcttattgctgctgtagacTGGACAGCGGGTGACGCTCGTGCC
gtacgagaaggagcacgTCCCCAAGTACCACAACTGGATGAAGGACCCATGGCTGCAAGGCGAGAGCGCATACAACACTGCACGACTGACTGTACAGGAC
AGTACACTGCCAACTGGAGCTCACATTATTTCGCCCTGCTTGTGCGTGTCTTGGACGCAGAGATGACGGCGTCGGAGCCACTGTCgatcgaggaggagct
cgagaTGCAAAAATCGTGGAGAGAAGACGCCGAGAGTatgaggaagaggagcaCTACGACTGCTAAAGATACTGTGAGTGACGTGTGCTTTGGTATTGTG
TGGTattgtttgttgttgttttcgCAGAGTGCACTTTCATCGTGTTGACGAACGCTGAGGGTGATGGCAAGCCGGGGGCTTCCTACGTCGACGAGAG