Description :
From Genome Similarity Track
Location :
Scaffold_18:501354- 502682
Transcript NameFunction/comments
Phyca_LT153462971Hypothetical protein

Sequence
1328 bases(100 bases per row)
acagcccgctaccacgaacgccacgaaagtaaggttttaaggattccaataatttcatagcagcgtcagaatcgcactttaaggcgtcagagcatcctga
tatatttgtgtgactcgatacgttagaatctgtttgcggggagcccaccctacgaacgagaccatcaatttgcctacgctgtatcaagttcaagcagaaa
aatttgaagttgcaatgcgtaacaaatcgccggtcgtgccatttcatgatgtgagcacagtattctgccaatttgtattcatgcattcgtcgctctcctg
cctctagttcatgcaatcccccttctccattgggaaagagtgtcggaaagcaattctgcatcagcatttttgtcgtatattcatttatcagatccttttt
gcaacgtagttcgccagtggggtaaattgtcttcccggctgcgtcatttgcggcatttataagcttctcgatttctgtgtgctcatcactatcggcttct
agttcaaatgactcctcaacattgatgcgctcgcccgatgcatcttgatgcggcggagaaattggtggatcagtatctgtgtttctatctaattcgggtc
tattaaaatttgcttttgcgcatgaattccttagttcctcgctttcaccgtctgtcaagacgatacttgggactactgcatcgagatcggcgttagcgag
ctccgctaaattttcctccgaaatcgacacagctttgtagaggggattgttagctattagccactgcaacgcacttcgcactacatcaggccgaactttg
agaaatgagacttctttgctagattcagttttcaaaagaactacgccacattttgacaacggccgcggcaaggacaaaactacttctcgcacatcattcc
aatagtttacagcgttaccccgtgtgaattcctgttggtctttgtaaagattcatgcatgtggtgaatgacacaccaagaccgactaaacgtgcttccat
tcggttgagaatagctagttctagtggtattggggctatacgaaagccactagctcggcaaaacttaggtatttcattcttagccaatgaggtattgcag
cggcaacatatccagataaagcggacacctgcgctatctggttccgtgattgcctcgaaaattggctcacatttgccttgttcatttttcaacgctgaaa
aatactttgctgtaggttcgtagcgtttccgaaccattcgtgctgacttggatagctccccgcagctcccgcatatccgcatcagcggatcgtcaatgct
ctcgtagaaggctatgcaaataaacaac