Description :
From Genome Similarity Track
Location :
Scaffold_49:50131- 57127
Transcript NameFunction/comments
Phyci_226362Hypothetical protein
Phyci_8093ATP-binding Cassette (ABC) Superfamily
Phyci_484124conserved hypothetical protein
Phyci_8095Hypothetical protein

Sequence
6996 bases(100 bases per row)
GCCTACCATGGCTTACTATGTTCAGTTGCTACAGATGATGCCGCAGAAAAACTACAATGGAATCATTGCCCTTTATGCCTGCATTGGGGTAATGAACCTC
TATTGTGTAATAAAGATGTCGTTCTACTCGCTGTATTATCGCCGGCTGGTATTCGGAAAGACGAAAAATTTGGAGGAAACTGCGGACGGAGGTATCGAAC
ATGATATGCGATACGAACAATTAACGAGGTTTCAGGCGTTTAAACGTTTTGCTGCTGGATTTGCACGATCCATTAGCGCTGGAGGTGAATGGTTCGATGT
GGTTTTACTCCAGCGAGAGGTTTCAGAAATTGCTTCACAGATTGTCCAAGCACACTCATCGAGCCTCCTTATCAGCAGCGTTTGGATGAACCAAATTTTT
GCCGGGTTAATCTTCTTGAATGCCTTTGCTAACACGCTGGTGCACTACAGTTTAAAAGAGAAGGTCGGCTTGAGACGTCTGTACAGCTCTGTCATCGACC
TGGCACTCGGCTTCGTCTGGGGATTTATTATTCCGTGCAAAATCATATTCGTCTATATTTCGTTGTTCATCGCGCACAATGGATCATTTCCGGATGATTT
CAACTATTCCGACACACTTCAAATTAAAGCAATTTTGGAGTGCAACCAATTCTTCATGGTGAGTTGGTTTGATGCCGTTACTACGACTTTACCTTACTTG
AATATGCTGTCGGGTCTGCGAGGCGTAAAATTTTTAATCCAGCATGATATGGAGATGGTTCAAGCCCTAGCGACGACAAAGATCCAACCTGTAGGGCCGT
CGGTGAACCTTGCAAAGTTGAAAAACGTAGCATCTTCTGACCAGCAGCCAGGAATCGTATCAAAGGAAGGATCGCGCTCGAAGGAACACCATGTCGAAAC
CAAACACAGTGTCTGGGGTAAAAGAATGAGAGCAGCCATTTGGTGGCTCATACCTATTTGCGGCGTATTTGTCCTTCTCACTTCCATCATATCGTCGGGT
GTACTATTTGAGAACGAAGATACCTGCGCGGCAGGTTGCAAACTGCGTATGCACCCGTGGTTTACACGACAATGCGCTTGCTCTGTCTTGGAAGTTAATT
GCTTTGAGCGAGGTATCACCGGCCGGGAAGGTGAAATGCGTGATATTTACCAGTCTCTGGATGCCAGGGTCCTCAACTCCCTCATTATCTCTCACTGCTC
CGAATTGGTCGTCACCGAGGATATTCACCGCTTCAGTAGCCTTATGACGCTCGAGTTTTACAACTCTACTATTATTGAGTGGCCTGCAAATGCTTCCCTT
TCACTTTCACACTTCCCTCAACTGGTCACACTCTATATAGTGCGTTCTCGGTTTCTCGGGCTACCAGACGGCTTGACCACTGATTTTTCAACGAACATCG
TGGACGTTGAATTCGCAGCGACTGACTTTGGTGGACTGTTGCCGGCCGACCTCGACAAAAAGTGGTCCTCGGTTGTAATGCTGTACTTGGAACATTGTGG
CCTTCAGGAGTTTCCAAGTGTCCTGACGAAGATGAGGCTGACCGATCTGTCGCTAGTTGATAACAACATCTCCGTCCTGCCCGACAGCTTAGGCGAGAGC
TCCATGTACATCATGCTGGACCGCAATCCCCTGGACCGTATCCCCGAGAACTTCGGGTCCTTGGAAGAGTTGGACTACCTCACTGTGCAGTACACCAACA
TATCAACGTTGCCGCAGTGGCTGCAAGCCGACGGCGTCTCCATAAATTTTCGAGCGAGAGGAACGCCCTACTGCCTCAACTTGCCGCCAAATAGTACCGA
GGCAGCGTTCGCGTGGTGCGCAAAGGACGACTACAGCAACGGCATCTTCCCACTAGCCATGCGAGACAGGGAGCGCGCCATCCAGACGGGCAATTAGGGG
GGATGCATCCTGAGCCGAGGCAACCGCAGCGTGTCGCTGATGCTTGTCAAACTGATTATGGGTTTTGGGCCACGCGCGCGGCCATCTGATTGGCCCATTC
AAAATGAACGAAACACAACGCAATCGACCTGCATTCCTGTCGCGACCTTCGAACGACATCACGCGTTGGTGCGCCATTCGTGCGACCTGGATCCTCGACG
CCGCGTCTGAGGTGGTCTCACTTCCGCTTTGATCTCGGCGTCAACAGGCATGTCGTTGCTGCACGGGCGCAGCATCTTCCTGCGCGGCGTGCGGCGCCTC
GAGGCCGTGCAGCGTGCGCGCTGCACGCCCGCCTCGTCGTCCTTGTGGCTGGGTAGACGCCGGTCTGTGCACTTGGTGCTCCCGGCGCTGGGCAACGGCG
TGCTGAGCTTCTCCACGTCGGCGATGGACGAGCAGGACAAGGAAAAGAAGGCGCTGGCCAAGCCCAAGCCGCTGAACGCGCTGAGCGGCATGGGGCTGGA
CCGCCCGCCCGACACGGCCAAGGAGATCCTGAGCTTCCTCATGGGCCACCTGTGGCCCAGCGACGACTCCAAGGAGGCCAAGGAGATCAAGCAGAAGGTG
CTCGTCTCGGCGGGCCTCGTGGTGGCCGCCAAGGCGCTGACGATCCAGGTGCCCTTCATCTTCAAGGAGCTGGTGAACGGCATGGGCGACGCCTCCAGCG
CGCTGGCGGGATCGCCCGAGATCGCGGTGCCGCTGGCCATGGTGTTCGGCTACGGCCTGGCGCGCTTCAGCGCCAGCGCGTCCTCGGAGCTGGCCAACGC
GGTGTTCGCCACGGTGGCCCAGAAGACCATCCGCAAGGTGGCTGTGCGCGTGTTCAACCACTTGCACGCGATGGATCTCAAGTTCCACCTGGACCGGCAG
ACGGGAGCCCTCTCGCGCATCATTGACCGCGGCTCGAGGTCCATCGACTTCGTGCTGCGCGCCATAGCGTTCCGCGTGGTGCCGACTGTGTTGGAGATCG
GACTGGTGAGCACCATCATGGCTACGAGCTTCGGACTGCCGTACGCCGGAGTGACACTTGGGACGCTCGCCGCGTACACGACCTTCACGGTGCTGGTTAC
TCAGTGGCGAGACGAAATTCGTCGTGAGATGAACCGCCTCGAGAACGAGGCAGGTGCCAAGGTGATTGACTCGCTCATGAACTACGAGACGGTCAAATAC
TTTAACAATGAAGAGCACGAGACTGCGCGTTACGACGAGTCGCTCAAGGGCTATCAGGCAGCGGCACTCAAGACGCAGACGTCGCTGGCGATGCTCAATG
CTGGGCAGAACGGCATCTTCAGTGTTGGTCTCACTGCCATCATGTACATGGCATGCGAGGGTATCGCTGCCGGCACGCTCACTGTCGGCGACCTGGTGCT
TGTGAATGGTTTGCTGTTCCAACTGTCCATCCCGCTGAACTTCATCGGCAGCATTTACCGCGAAGTGCGCCAGTCGGTGACAGATATGGAGTCCATGTTC
AAGCTGGGCGCTGTGACGCCGGTTATCACAAACCCGGAGGAGATGCTGAGTCTCAAGGGCAGGGAGCCCAAGTCGATTGAGTTCCGTGACGTGGAATTCG
GGTACCGTCCCGAACTCCCGATCCTGCGTAAGACGTCGTTCAAGGTGGAGGCGGGCAAGCGCGTTGCCATCGTCGGCACGAGTGGTTCTGGCAAGTCGAC
GGTGCTCCGACTGCTCTACCGCTTCTACGACCCGCAGAATGGTTCAATTCTTATCGACGGCAAGGACATCCGCCAGGTCAGCCTGGACGAGCTGCGTCAG
GCGATTGCTATCGTGCCGCAAGACACCGTGCTGTTCAACGACACGATCTTCTACAACATCAACTACGGCCGTTTGGACGCAACGCCGGAGGAGGTGATGA
ACGCCGCGCGCGTCTCGCAGATCCACCGCTCCATCGAGGCATTCCCCGACGGATACAACACGCGCGTGGGCGAGCGTGGTCTGAAGCTTTCGGGTGGCGA
GAAGCAGCGTGTGTCGATCGCGCGCGCGATGCTCAAGGACTCGCCGATCCTACTGTTCGATGAGGCCACCAGCGCGCTCGACTCGGAGACGGAGTCGGAG
ATCGTGCGCGAGTTCGCGTCCATCGGCGAGAACCGCACGTCGCTGATCATTGCGCACCGCCTGTCAACCATCCAGGACGCGGACGAGATCATCGTGTTCG
ACAAGGGCCACGTGATCCAGCAGGGTTCGCACGAGGAGCTGCTGCGCGACGTGGAGGGCAAGTACGCCGAGATGTGGGCGCGCCAGAACCGCCACGTTCT
CGGGCTGCTGGACAGTGGTGACGACGACAACGACGACGTAGATAAGACGGAGAAAAGCGTTTAGATTCTGACGTGGCCGTAGAGCTGTAGAGTCCTGTAG
AGTCATGCAAAAAGGCAACAAAGCACTTCAACATGCCGCGTTCGTGATACCGTCACTTTTTACCGTCAAACTTGAGTTTTCACCTTTGATTTTACGTTAC
AATCTAAAATTAATCTGAAATAGTCTGGAAATAGCAGAGCTCGCGCATCACATCGCATCGCTCGGTCGTTGGCCGCCATGGACGCGCTGTTGCTGAGCGC
CCAGCGCCTGAGCGGCAACTCCAGCAGCTCGAGCTCCAGTTCCTACAGCTCCAGCGACGACGAGCCGCTCAGCGTGTCGCTGGCCAAGCTCCAGAGCCCG
CGCGCGCCTCCGCCTCCGACGCGAGACGCCAACGGCATGACGAGTcccccgccccctccgccgcccgactccccgccgccagtgccgccgccgcctccgg
ggccgcccccggcgctgccCGGCGCCAAGCGCAAGCCAACGCGGCGCCCGAAGTCCAGCAGCGTCGGCAGCAGCAGTTCAGCCGCCAAGAAGAAGAAGCC
TGCCGCACGAAAGGCGACGCCGACTGCAGCTCGCAGTAAACGCAGCACTGCGGCGCCACGCAAGACGCCAGTgaagaagaagcaggagaagaagccagac
attgagatggaggaggaagaggagaCGCCTACGGCGGAGAGTGTTCaggaagaggaagaagaggaggaggaggaggaggaggaagaggaggaCCTGGACG
CGTACTCGGACGAGTCGGACGTGTTTGAGGAGGATGTCGAGGCCGTTTTGTTCGCGGAAGAGGAGGAGGACCGACGCAAGGGCTACACAGACTGCCTCAC
GGAGACGCACCTGGACAGCGTCGAGTACCCGTATCCGGCATACCTCGCGAAGCTGTCGGCGCTGTTCACCGAGCAAAGCGCCTTCGGGAAGAACCCCGAG
GACTTTATTTATTGCAACAATCTGCTGGTGCGTGCTTCTGCGAGGAACGTCGTTAAGAGTGGGGATGGAGCTAATGGTGGTGGTGCGTATCGCGTCTGTA
GGTAAGTCCGGGACAGCTGAAGTTGTTGGACGCTCGAACTGCAGCAATGGAGCGAGAGAAGTTGCAGCAGGTGCGGGCAGCAGCATCACTCAAGGCCAAG
GAGGATAGGAAGAGACGGCGTCAGGAAAGGTGAGCAACGCAAGCCTCTCCATCAACAAACAGCGCTAACACTTGGATACTGGGTTGGTTGTTACGTTACA
GATTAGCGGAAGCACTGCAGCCACCTGTCAAAAAGCTCAACATATCGGAAGCAACTTTGAAGGCGCTGGAGTCCAAGCAGTCTGCATCGATTAGCAGCTC
GAGACCCGCAGCCAATCCTAGTCGGAAGCGGAGTCGAAAGAAGCCCACTGCAACAGCCACGGCAACAACAACCCCAGCAGCTACCATAGCTTCTTCGAAC
CCTGCAAGTGATGCTTCTGTAGCTAGTAGTAAGCAAGCAGGGACAAAGTCAAAACCAGCCCCGACTGCCAAGACAAATGGGAAGGTGAATGGGAAAGCGG
TGGTAGCCTCAGCTGCCAAGAAGAAGGCAGCAGCTCCGGCTAGCCGTACCAAGAAAGCTTCAACTACTGCTACCAAAGCAGCCAACAAGCCAGTCACTGC
CACATCCAAGACTAGCAAGACTACCAAGGTTGCACCTGCTCAACAGAAGGCCGTGACTGCTCCCAGCACTTCCAAGGAGCGCAGAGTGCAGGCGGAAATC
GAGAAGAACCGTGTTGAGGTGGAAGAAGACCCTGGTAACGAGAGTtcgtcctcgtcgtcgtcttcctcctcctcctcgtcttcttcgtcatcttcgtctt
cgtcctcgtcatcTTCCTCTTCGGTCTCTTCCAGCAGTAGTTCCTCCGACGACGACACAGGAGAGGAGTAGGTGGATCAATCGCAGGCAGAAGAACGGAG
CCGACCAAAAGTTTTCGATTAAATTTAAAATGCCATTGCGCCCGGTCTACAGCACGCTCTGCTGCTCCTCATTCTCATCGCCCCGAAGCACCACTGCGCC
CTGCTTTTCGGCCCAAATGCCCGACGCCTTCTTGCCCAAGTCGAAGAGTTGGTCCAGCACCTCGATCTCCGGCGGAAACAGCGCGAAGCGAGCCAACTGC
ATGATGTTGTACGGGAACTCTGGGTCGATGGACGGGCTGATCTCGTAGTCGTCGCGTCGCAGCACGTGCGCGTGGAAGGCACAGACTTTCGTGTACCCGG
GCAGCTCCGGCACCAGCGTGAAGAGGCCTCCGTCCACGTGATACTCTCCTCGGAACACCGACGTGCCTCTGTTGGCCAGGTACCAGGGCACGTAGCAGGA
CGCGATGACCGCGTCGCACAGGTCCTCGGGCGAGTGGAAGTCGTCGGTGAGCACGAGCGCTCGGTCGGGCCACATCTTCTCGGTGGCGATCGTGAGCCTC
GCCGCCAGCGACTGCACGGGGACGTCCCCGAACTTGACGCGGAAGATGGCGCGCAGCCGCTCCTCGAGCTTCCAGACGGTGCCGTGGCTGTGGCACAGTC
TGGCCATGGCCTTGGTCTCCTCGTGGATGTCGCGCATGCTCACGCCCGCGGCCAGACTCAGCGCGGCGATGGAGCCGCCCGACGCGCCGGCGAACTTGGA
CTCGGCCTGGATGTAGCCGGCGTCCTGCAGCCCCTGCGCCACGCCCAGGTGGTACGGGATCAGGAACCCGCAGCCGCTGAAGCTGAAGTTGTGCGG