Description :
From Genome Similarity Track
Location :
Scaffold_75:5012- 7854
Transcript NameFunction/comments
Physo_139504reverse transcriptase

Sequence
2842 bases(100 bases per row)
CACTTCCTCGACCTTGGTGTAAGGTACACCAATGGCTACATACATTTACGACCACCACGACGGGTGGTCCATACACATTTAGGATTCCTATTGGCTGAAA
GCAGCATCTTTTAGCCAACGAGTGACTTGCATGTTAGCAGAATCCTGCCAACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTAGAGGAAGTC
AGAAACATAAAACAAAAATAACAGTTCTCATCTTTTACCAAAACCCGCTACTTGGAGTCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACT
TAACTCAAGTAAAAGAAACCTACACTTCCTCATACACGTGCGCACACGTGTAAGCCGTAGTAGTGAGCCAAGGTAGGCCCATTACCTGGTAGCACTTCGT
AGTCCGTCCAACGACCAACTACCTGAACGTTCGTACGGAGCTGTACGAACGAGGAGCCGAGAACCTTTTCATGAGCGCGGAGGTGCCCATGGAAAGCTCC
ACTTCGCCTGCAACTCATGTTGCACGCGCTGACTGCCTCCACCTGTCGGATCCAGAGTGGGAGGCACTCCAACGACTGTCAACAGTCATTGGGGAGGCTG
CAATAGCTGCGATGCTGCGTACGCAATCACCGACAGAGCAACATGGTGTTGCTCTGGGGTTCATCATGAAGGAGCAGCGTGCTGCTGCTTCCTCTACCAC
GGTAGCATCGGAGACGACACCGCGTGGACAATCGTTGAAGCTCAATGGGAGCGACTATGTCGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAA
CCCGACACTGCCATCGCGGCTCGACGTATCGTCGACCCGTTGTCCAAGGTTGCGTTCGCCATGTCATGCCTTGGCGGACGAGCGAGAGGTTGGGCGTATG
GGCGCCGACTCTCTGATCCTACGTGCTTCAGCACGTACGAGGGTTTCAAGGAAGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAATGAGTTTCGGTCGAG
GGCAGAGTTCCTCGACCTACAGCAGGGTAAGCATGATGTTCATGCTTACGCCCAGAGAGCGCGGTATTTGGTCTCGAACATTGAGACCAATCCGATCGAC
GAGGCGACCAAGGTCGTCACGTTCATGAAAGGACTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTA
CTTTTGCAATGCATGAGGAGTTTAGCCTGCGACAGGCCAAGCTGCATGCGAATGCGCCGAGGCTGCGACCGCCTCCGGTTGCGATAGCGGGAGGTCCGGA
ACCAATGGACCTCTCGAATGCAACGGCTGCTGATTATCAACAGCAACAAGGAAGTAATGTACGATGCTTCCGTTGCGGAAGGATCGGTCACTATGCCCGA
GAGTGCACGGCACCCCTGCACCGAGATGGTGGTCGACGCGATGATGCCCGGCATCGTCGCGGACAAACAAAAAACGCTGGAACTCAGTAGGCGCGGGGCG
CCCTACTGGTGAAGTAGTCACGCGTGTCCAACTCGGACATGCGACACTGAGGACTGCAGCCCCCAGTGAGGACCCTTCTCACTGCAAAATGCATGATGAC
AAACCGAACCTTGTCATCTTGGACGTGTCTTCGAAGAGAGAGAGCAACTCTCTTCGTGCTTTGGTTGATTCGGGCGCGTCGAACAACTTTGTTCGACTGC
GAAGTCTATCAAGGCTTGACTTCGAGGAGGTAAAGATACCTCGAAGTATGTTGGAGGTACGACTGGCAACGGGTGCCGTCGTGAAGACTGGGAAGCGCAT
GGTGCGCGTGCGCTTCACGTATGAAGATCAAGCGTTTGTCGAGACCTTTATCGTCCTGGATCTGGGTGATAAGTTTGACATTGTATTGGGCATGGCGTGG
CTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACACTCGTGCGCTTCGGTCGCGACAGCGGTACAGTGAGCGATGGCCTTGTTGCCGCTACGC
ACGCACCGACAGATGCGCGCGACTCCCCACTCGAGACAGCACCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGCAAGAGCAGCAAGCGTCGGCG
TCGCCGCCGACGGCTGAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCGCTTTTCAGCGAATCAGAAAGAGTCTCCGAGCTCACGGGGCACGGATG
ACGCAGGCGAGTCACACGCCTTAGCCGTGGAGGCTGACGTGAATCTAATTGGATCCGTTTTGGCCAATAATAAGAGCCAAGGTGACGAAGCGCCGTCGAC
TCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTACGTAATGGGGGTTTCCGCCAATGGTTGGCGTCGAGGTATT
AAAGTCGCGACGGTTCCGGGAACCGGCGCCGCGAAAAGGAATTTCGCGTCGACTCCGAGAGTCGACGTACCCCTTGTAATAAAGGGCTCCGCCAATAACA
GGCGTCGAGGTAAAGATGGCGTGTCGACTCCGGGAGTCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAACAACTTGCATGCTGTCG
TGCAGCCGGGCTGCACGACGAAGCGCCGGGCGTCCAAGCCGGGCTTGAAGTCACTCGCCCGCGGGACGTACCCGCCGGCGGTACTGAAGAAGAACACCCG
TCCACGGCTGGGCGTGGACGAGGTCAAGAGTCATGCGGAGCCGGGCTCTGCAGGACAAGAAGATGGCGCATGCGAAGATCGCTGCGCAAGTCTCGGCCCG
GGGCCGAGACGCTACAAGAAATGTCTCCCGGGTAGACGGAGG