Description :
From Genome Similarity Track
Location :
Scaffold_134:50114- 53469
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_134-abinit-gene-0.61Protein kinase
Pytap_DAOMBR444maker-pag1_scaffold_134-fgenesh-gene-0.11Carbohydrate-binding protein
Pytap_DAOMBR444snap-pag1_scaffold_134-abinit-gene-0.74LMBR1 domain-containing protein 2 homolog A

Sequence
3355 bases(100 bases per row)
GTGCTCCAACATGCTCTGCTGTGgAGGgCAGGCTTCATGACGACTACAgAGGgCTCAGTGTTGGAGACGCGCACTCGGTGTGGACTCTCCATCACAGCGT
CGATGGAACTCTCAACGTTTGCGGTGCCCATGTGCGCCGTACGAGGGgCGGCTCCGAACGAGTCGACAGTATGGCTAAGGTTTCACGATTCGACAGTCCT
CCCCGGGACTGTGGCATTTTCCACAACTGCCACGCAGAATGCAGACaTCGTTCCGTGTTCGACACGAGACGAAGACTTCAACTCATTTTGCCAACCTGAA
GATGCCAATACTCTATTCGAATGGCTGCGTACGGAGATGTCCCCAGATGTGTCTGTAGCAGCATCCAGCACATCAGTAAATGGATCGCCACAGAGCACAG
AGGATGAAATCGTACGCGCTTTCGCCAACATCACGACCTCGCAGTCCGCGGGTCCTATGGGGCTGGCGTCAGCTGACTTTGCGTCTGTCTACTACGCATT
CCACACTTCGGGGATGACTCTGCATCGCATCGAACTCTCGTCCGAaACTCCTCctGATGTAACTCAGCGTCTTGATGCCTCCcAGCTCAAGTTCAAGAGT
ATTACGGGCTTCCTCCAACGCGCACTTCTATGGGATACAGGCTATGTGATCGTTCCGCATCGAGGCAGCAGCACGAAGgTGGATGTTGTGCCTGTGTACG
TCAAGTGCGGATTGAGGATGGCGGATCTGGCCCTTGATCGCAGCTACTTCGACTCGACTGGGTGCCCAGTTCTGGATTGCTCTCGTCGAAACGCCTCCAa
tGACGGCGCCGTTCGCTCGTATCGGTCGACaGCGTGTTCATCAGGAGGCAGAGGCAGTATTGATACGCTCAGTCGTTGTGCTGTTCCTGCGGATATCGAG
CATGGAGTCACCGTGCCGgTTGCAGCTTCGTCAACAATTTGGGCGGTTGGAGATATCGACACCACGAACAAAaCGGAGATCCCGCACATGTGGCTACAGC
GACTGCCTTTGACGAGTGGTCGGTACGCCATTCACTCTGCTACTGAGGAAGCACCCGTGGGTTCGTGTCCATCGTCTCCGtCGTTTGTGATACCGTGCGT
GACAGTTGATCAGTCAAGGCTTCAAGAAGTGTGGTGTCGCCCAATCCAAAGTGAGTTAGTGACGACGTGGCTCCatGAAGAAGAGCACCAGGAGATGGCC
CTCtCTACGCTGATCCTTCTCGCCGGCGCGATCCTTCTCGCCCTTGCGCTCGACTTATTCGTtGATCGTAAGCCCCGCTTCTTCGCAAATGGACGTGTAA
GCGTGTCAATTCCATCGATCACTAGCACTGTGCTCGATCCGAACGGAGAGCAGTCTGTGACCGTCCACAGTGATCGTACGGGCTcGTCCAGCTTTCGTTC
GGTGCAGTCAAATCGGTGAGGTGATCTATTGTGGAataCTAGTATCGACTACAGCACTAGCAAATCGGCTCACGCTTGCCTGGAGACGACACTCCGCGTC
ACGTTGAAGCCAGTCGCAACTTCCCCAGATGCTGCGTACACCATCATACCGCCGCCTTGACCAGGAGCTCGAGCGAACGCGTTCCAGCTTTCAATCACGC
TCGCGCTCGGGCCCGGTCCGTACGCGCACGACGCGTCGACGCAGAGCCCGATGGTCGCCTTAGTGAAGTCTCCCTTGAGCTGGGTCTTCCACGCAGCTAA
GGTTGTGTTGAGGGCGCTCTCATACACAGCCGCAGCGGCCGTGGGGTCTTTATCCACGTTGTACGCCATGATATTGACCCAGTCAAGCGACTCGAGCAAA
GTGGCCGGAAAGCATCGTGAGTACGAAGCATACGCAGGGTTCGCGCAGAGTGAAGAGTCTCCCTcAGTGAAGTACGCGTCGTAGGTCAGCAGTAGTGTCT
TGTCCTTGGCATCGAGCGCCGCGCGAGTCGCCTTCACAAAAGCGACCACCCGAGTGGCGTTGAACTGCGATCCGGTGGTCTCATCGTCGATGTCGATTCC
GTCcAAGTCGAACGCTTCCACCAGTGtcACAGCTGACGATGCAAATGCCTCTGCGTCTGTCACGTTTGCGATGGCGTCGTTATTGGTGGAACCGCCGATA
CTACCAAGCGCCGCGATGCACCGCCTGTGCAgAGCCTTCACACAGCCTtGGATCTCAacGTCAGTGTTCTGGAATGCGGCAGCAGCTCGACCGTCGCTAC
CGACGAGCGAGAAGCCGAAGACGACGTGCGTCACGCCTGGTGGTATCTACAGGGGAAACGCCTCAGTCGCTGTGCCTCCCCcGCAtcTCACGCtGTGCAC
TGTACAAACCTGTTCACAGCCGTCGACTTCGCTCTGCCAGAATGCGACTGTCCGCTGGTGTGGAGGTGGACGACGCACTGCACAGTCTTCAGAGGCAATC
GATGGGGCTTTTGTGCTTGGGGCCGGCGCTAGTGTTGGGTCAGTGGCCGTGGCGTTGTGTGTAGTGTCCGTAGGTGGActAGAGCTAGAGGTtGTGCGGG
AGGAGCCTTGTTTGCGAAGCACAAGGGCGACGGCGACGACGATGCCAATGAGGAAGACCACTGATAGCAAGTCAAAAGCGAATGAGCGAGGAGATAGCGA
TAAAGATTAGCTCGCTTAGTGTTTCACGTACGGGAGAACGCAGAGAGAAGGCGTCTGTGCCTGGGTTGGCGCTCACGCTGGCGGCGACGACGGCTTGAAG
GCGTCTCCAAGAACTCCTCTGACGATCGATATGCATCAAGGTCGCCTGCCATGGCGGTCTCCGATAAGGCCGAAAGAGGGCAAATGAGTAGACACCAGTA
CGCGATGTGGATGTTGATACCGCCTGGGTTCACTTGCCAACTGGAGGCACCCTATGCAAGAACCATCTGCCGAGTAACCTCTGTTCCGCGACACACACAC
AGTAGCGTTTGACATGCAAcAGCAGAGGGAGAATGGGAAGCGACGATCACActGTTCATCTCCTGATGCTTATGAGACAATCGTATGTTGCTCCAGGTCA
TGGCCGGCGTAGTCTTGCTCCAGCAGCGACGCAGCCATGTCCGGATTGGTGTCATCGAAGCCACGGccccGCCACTGTGTACGCTTGGGCGGATGCGTGT
GGTCCCGCCGCAGTCTCTCGAGCCCCTTGCGAACGAGGGACTCGCCCTTGTCGATTTGAGCTTCGTGCTCAGGATGACCAGGAACGAGTTGCTCGTACTG
CTCCATGCCTATCGACTGCTTCATCACGCGAGCGTAGACGTTTGCCTTCGTACATCCGACCAGAACCACCATGAGCACTGGCGCATACAACGAGAAATCC
TGTCCAAACACCCGAACGACTTGCATGTGGCTCCAAAGACGATGGAATGCCGTGG