Description :
From Genome Similarity Track
Location :
scaffold_333:5011- 6537
Transcript NameFunction/comments
g7370.t1hypothetical protein

Sequence
1526 bases(100 bases per row)
CTGTAGCTGGGCTCGATAGCGTTCTTGTCCGAACCTCGATCGACGTGGTATTGTCTTTTCTCGACTTGAACTTGAGACTGGGGAACGTGGTCTTTTTATC
ATTTTCCTTCAGACTATTGTACAGAGCTCGCGATGACTTTATCGCTTTCGTGAAATCGCGATACGTCTCGTTCATGATCTCCTCGGGAACCTCCAGATGA
CATTCAGGCAAGTACTCCGTGAGGGAATGCTTTTGCGAGATGCCCCTGTACTTCTGATCAAGTTCTGTCTTGGACAACTTGTAGCAATCGCCCTTCGATA
CCTCAACGAGTTTGTTGTAGATCGTTCGATGCGTCCCAAACATTTTCTTGAGCAAAACCTTCTGCTCCGGCGTCGGGTAAAGCCTGGTCTTCAGTATGCT
GTTCGGGGACTCCTTCTTTTCGGGCTTGCTCTCGTCGGAGACGTCGCAGGATCCCGGCTTTCTTTCCATTGCGTCTGGCAACGAAGACGTTGACGATGGA
GAGGAGGTCCTCCTGGAGTTCTTGCGTTTCCATGTCTTTCGACTCTTGCTCCCCGCGTTGTTCGTCAGCGTAAACCACGATTTGGACGTTATGCTCTTTA
CACATCTTCTCGAAGAGCTCGTACCCGAAGCGCAGAAGTCGGTCTTTGAAGGTAACCACAATTCTTCCGATCTGCTCCCGACATACCATTTCCACCAGTC
TGGAAAGCCCTGGCTTGTTGTAGTTGAGACCGGAACCAATGTCGGTAATGACCTCACTATCTGGGAAAGCAGACGATAGCAGCGCTTGCTGTCGTTCAAG
ATCGGGTACTTGTTTGCTTGATGAAACCCGACAATATACGATCGTAGATCGCGGGCGCGTCGCGCCCCCGGGTAATGCAGACTCATCCACTCCTGGTTCC
ATACGACGATCGATCGATTCAAGATCATACAACCACGTTCGACGCCCACTAACACTTCGGATAGCTCGGGCGTTAACCACGCCTTTAACAGCCCACCCTC
GTAGTGTTTCAGGAGCGATATCAAACACCTCTCGAACTTTGCCTGACGCAACATACTTCGGCAGCTGCAAATTCTGGAATGAAGAGTTGGGCAAGATTGC
TCGGTATTCCTTCTACAAGTGACCCTTCGTTTCTCAAATGTTTGTGTTGAAACAAAAAAAAATGACGCAACTCGTTGGTTTCAAGTGCTACATAGGCAAG
TATTCCGCAGCGATATCTTGGATCTGCACAACCGGTCGCGCCTTTTGAATGGACTGATTGTTGTTGCTCTCCTGTGTGATAGCGACTGCAGAGGAAGGGG
CGACAGTATCAAGCCAGGAGAAGCTTAAACTGAAGTGTACGAGGAACATCGCCAATCGAATTCCTCCCCAAGCATCAGACTCCAATCTAGTCACACCCTA
CTAAGGGCAAAGCTGGCATGGTGCGTCTTTTGCATCAGCCATTTGACGATTTCAGGCTTGTTGAACATGTTATTCAATGCTTCCTTCTGACAGCCGATCG
GGTACGGATGCGAGCCGGAGCTGGGT