Description :
From Genome Similarity Track
Location :
Scaffold_18:50107- 53268
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_18-fgenesh-gene-0.1060S ribosomal protein L35a-4
Pytve_DAOMBR484maker-pve_contig_18-fgenesh-gene-0.28Ferric reductase like transmembrane component

Sequence
3161 bases(100 bases per row)
TATGTGTGTGCAGAGCCTAAGTTAAAAATGGTCGCTTCCTCGGGTCAGCCTACTCGCCTCTACGTCAAGGGTGTCTTCCTTGGCTACAAGCGGTGCGTTG
TTTGCTGACTGAGTGATCGCTCCCGTCCGTGATCGGCACCGACTGACGTGGACACTTTGGATGCCTTCAGTGGTCTGCGCAACCAGTACGAGCACACCGC
GCTGGTCAAGATCCAGGGCCTGCAGGACAAGAAGGACGTGGACTTCTACCTGGGCAAGAAGATCGCGTACATCTACAAGGCCAAGACGCTCAAGAACAAC
ACCAAGTTCCGCGTCACGTGGGGCAAGGTCGTGCGTGCTCACGGCAACAACGGCGTCGTGCGCGCCAAGTTCGCCAAGAACCTGCCGTCGGAGGCCATCA
GTGCCCCGGTCCGCATCATGCTCTACCCGAGCCGCGTCTAAGCGTGGCGTGTGGCTCCCCACACTTTTGGCTTTCGCTGCCTGGTAACACATGAATACGA
AGAGGGATTGTGACCACTCGCGGTGTGCTCGCCACTGGACTGGACGCGTTGACGCTTGGACGTGACGCTAATCTGCTTGCGCGATGTTTCTATCTTCCCT
GTCAACGCTCCGTTGCCAAGGATCCTCCATCACCTTCATGCCTGTGTGCAGTGTTGTGGTGACACAGCGTCGAACCGTGTCCCCACCACGACCAATGTTG
GCCACCAATGCAAAGCGCTCAACGTTCCTTTACGACGATCAACATTAAATCCGGCCTCCTCGAGCAGCTTGTCTGCTCGCTACGTGAGCCACCAGTCAAT
ATAAAACTACATTTCAAACTCCTCAAAGTGCACGTCGAAGATGCCGGCAAAGTTGGATGCCTCCGTCTCAACGGCGTGGATGAGCGCCATCGGACCAGAG
ACCCACGTGCCGACGCCAGTGACGTTGATGGCGAAGTTGTGCGACTGCTCCTTGACGACTTCGTTGAAGAGCTCCTTGACGTTCAACCGCGAGCGGCTCA
CCGGGTGGCGGAACTGCACCTCCTGACCGTCGAACGACAGCGTGTGCGAGTAGTCCGAACCCCGGTCGTCGTCCTCCGGGATCGGGCTGCCTCCGAGGTT
CGGCATCAAGCGCGACTTCTCCATACGGCTCATGGACCGAGGCGTGGACTCCGAGAAGGCGATCACCCAGCCGACTGCGGCACCGCCGACCATGAGGAGC
ACTTCCATCACGCGCTGCAGCGGCCACATGTTCTGGTTCACGCGGTTCTCGCCCAGCAGCGGGTAGTTATACCGGATGAAGAACATGCCGAGGAAGCTGG
CCGTGAACGTGAGGAAGAAAAGCAGCATCTGGCGAGACACGGAGCGCGACGACTGGAAGAACGGCCGCGTCGGCACCATGCTCGTGTCGTCCATCGGCTT
GAGCGTGATACCGTTCGGGATGTCCACACCGCCGAGATGCTGGTCACCGGTGAAGCAGAGCCGCACCTTGATGCGCGAGTGGTCCGGGTCAAACTGCTCG
ATGGCGTCCAGCAGCGGCTCGAACTCATGGAAGATACCGATCTCGCGCGACGTCCAGTGGAAGTACACCTGCGTGTGCATCATGACGGGGTCGTTGTTGC
GCATGCAGTCCAGGATCTTGCCGACGATGCTGATGATAGGCGTCGCGCCGATACCACCAGCGACAAACACGAGCGCAGGGTAGTGCTGGAAGTCGTCCGA
CATCTTGCCGTAGAACCCGTCGACGTAGATGAGCGGCATCTTGCGCTCCTCGCGAGCCTGGATCGCCAGCGCGTACAGCGACTTGGTGAAGTTGCCAATG
CACTTGACGTGCACTGTGAACGTGTCTTCGTACTCGATCGGCGACGAACTGATGCTGAACGGATGCCACTGCGTGTGCGACAGCAGCGGCACGCGGAGGT
ACACGAACTGGCCGGCGTGGTAGTGGCCAGAGGACCCTGGCGCGCGACGGAAAACGAGTCGCGTGATCTCACCGGGGATGGCTTCGAGGTCGACGACTTC
ACAGGGCACGCGGCTCTGCGTGTTGGACAGGATGCGGTGCATGACGAAGAGGCACGTGGCCGGGTACATCCAGATGACGAACTGCGAGAAGTGAAGCGCC
GAGAAGAAGAGCACGAAGATGAAGAGGTGGTGCGAGTAGTAGAAGAGCTCGTAGTACCGGCGGCGGATCGGGTTGAGCGAAGTGATGCCGATGATGAGCG
AGCACAGCAGCGCCATCTGGCCGCAGAAGTTGGTGAAGCGCGACTTGCCCTCGGACCCAAAGTCGCAGTCAATGCACGGCAGCGACGACGAGATGAAGGT
GCCGGCCTTGAACCACGCGTAGTAGTACGGCACGGCGTGGAAGAAGACCATGGCGACCGTGAAGAAACCGATCCAGCGGTGGTACTTGATGGCGTGCGAG
TAGTCGACCCCCATGGCGAGCATCCAGAAGCTGTTGCGCGTGGCCGGGAGGATCAGCAGCGAGAAGCACAGCACGGCGTTGAAGCCGAGCGTGTAGCCGA
CGAGCTTGAAGATCCCCACTCCGTCCGCGGCGTCGGCTTCGACCAGGTCGGCGTACTTGCGCGAGAACACGGCGGCGAACCAGACGGCGTTGAGGCCGAG
GAAGACGATGGTCGTCAGCGACTCGGCGTACGAGATGTTGACCATGCCGACCATGATCTTGCGCTTGAGGAAGCGCATGATCGTGCGGTGCGCTCCCGTG
GGCACCGGCGGAAGCGCGTTCCCTAGCGCGAGCACCATGCCGCCGACCATGGTCGGGAGGCCGATGAACACGAAGTTGACGGCGAACTCGACGACCTCGC
GGTGGCCGCCGACCCACTCGCCGTCCTCGACCGACGAGCCGAAGAGGTAGTAGATCTGGTAGCGGAAGCCGAGGCGGTACTCGGACATTTCGTGGTAGAT
GTAACCGAAGAGCACGATGAGCGCGCAGACGGCGACGACCGTGAAGGGCCACGCCTTGTAGTTCTTGTGCACCGGCGTGCCGTAGACGAAGGGCGTGGCG
AGTCCCGAGGGCTTGCCGCCCGGCCCCGCGCCAGGGTAGTTGGTGCCGCTCACGCTCAGCGCGAAGAACTTGCTGTCGCCGTTATCCGTGCCCTGCGCGC
GCAGGTCCATCGACTCGGCCGGCGAGCTCATGACGCTGCTGTCCATCGAGTAGTTAACCAT