Description :
From Genome Similarity Track
Location :
contig_141:50102- 52670
Transcript NameFunction/comments
g11668.t1hypothetical protein

Sequence
2568 bases(100 bases per row)
CGTATTTAATATTATATTCATATTAAAAATACTAGTCACAATGTATTAAATCTCATGTGAAATGCTATAGGGAAATGGTGGCCGTAGTGCACGGATTCCC
CAGCAAGTTCCGCGCGCTGCAGTTCGAGTGGGTCTGGCAGCCCATCGGTGAGTAAACTCACTAGGAACCATCTTGAGTTCCTGCGAGGCTCGAGAGGACT
GGGGGCTCCACGGTCGGTCAAGAGGAAGGTGGTGGAGATGCTGGAGATGGTCAACCTGGACCCATGGAAGACGCTGAACCTCACCGTGAGCTTCACGACG
GACGAGGTGCACGACATTGCGAGGACGCTGGGGGCAGATACAGCGCTGCAAAGTGCGACACGAGAGCGTTGATCACTTTTGCTGACGTCACTTCAACTTG
CAATTGTTTCGTTTGTGAGTCCACAGTAGAGGACAGTTTGGATGACGCGGTGGGGTGTTATCATGACGGGTGCGACATGTGCTGCCATCCCGAGTGTTTG
GTGGACCATTTTCGGTCCATGAGAGACTCGGAGGAGGACGAAGAGACGAGTGGAGAGTGTCCGCAATGTCAGCAGGTTCTTAAGTGCCGTTTGCTGACGA
AATATCATGGGGAGAAGAAGAATCGGAAGAGACGACGTGGTGGACGCAGAAAAGGCGAGAAAAGAGTGCGCGTGGCAACTGCACAAGGGACGAATGATGA
AGAAACACACCCTCTGCGTGTTGTGGAGCAAGGCCCAACTCCAGATGATAGTAGGCAAAAAAGATGCGACGGAGAGGGAGTGGATGCGATTATCATCGGG
TCGCCGCCTTCTTCAGGAAGTTTTGCGGCTGAGTACAATTCGGATGGCTGGTTTGAAGACGATGGGATTTACGCTAACGATGGTGGTGCAGGCTGCAAGG
ACGCGGAGTCGGAGCAAGACTGGAGGTCGCAAGCTCCTCTCCACATCCTCGATGTTCATGTGCCCAAACCTGCCAACGAAGATGTGGAAATGATCGATCT
CACGGAAGAATAATCCACTTTTTGAATGCAATTGGATGAATTGACTGAAGGGGATGGCGTCTATCCGTCCTGAACTTTCGGGATGCACATTGCAACAGGC
GAGCAAGGTGCCGTGTAGCAGTCCGAGTCTACGAGCTCGCAGTCTTCGCGCTCACTACAGCGATCTGGTGAGCATACGTCGGCACAGTACGCAACAACAG
CCTCGTCGGGTTCGATCTGTTCAAGGCACTCAGTGTAGGCGGGGCAGGTCATCGTTTCACACGTAAGCTCTGTATCCGCATCACATTCGCCATCGTGCAC
AACTGTGAGCGCGTGTTGCGGGTGCTGGCACCTCGCGTTGGCAAAGAGACACAGGTTGTCGTGAGTCTGGCCATCGGACCCGCACACGGGCGCGTAGGTG
TATGGACAAGGTCCGGGGACGCATGATTCTCCACCATTGGCGTTACTGGGTGTGCTTGCGCTACGAGCAGCTAGCATGTGCAGCGGACACTTGCCAGCTC
CGAAGGCCTTGATGCTTGGGTTGCGGCACTCAGCGTACTCAAGCAGACACGAGTTGGCGTACGTGATACCGTCTGAGCCGCAAACAGGATCATATATGCG
CTCGCACATTGGGTTGCATTTCTCCGGTGCTGCGGTAACTCCTTCGTCGGTGGCAGTCTCTCCGTCGACTTCCAAGACAGCCAAAGCGTCGTTTGCATCT
TGGCTCTTGGCACATTCGCCGTGTGAGGCCTTTTCCAGCTCTGGGTGCTCGCACTTCGACGACAGAAGGTGGCAATCGTTGATGTACGTGACTCCATCCG
TTCCACACACTTGGTCAGGGGTCAGCTTGCACGTGAGAGAGCAAAACACCGTCTTCAGGTCTACTTGGGTGCTGGAATCCAGCTGCTCATTAGGGTCGAG
AACTTCGACCTGCATGTCGGAGGGTGGCGCGCTTGAGACCTCTTCTTGGTCTTGGCTGTCGTCAGTCAAAGGAGGACAAACTCCTAGAGCTCGGATAAAG
AGCGTGTCTGGGTCACTTCCCCCGGAACAGAACGTTGAGGCAAAGACGCAGTCATTGGCGTACGTGATCCCGTCGGACCCGCACACTGGGTCATACGACA
CCACCTCGCAGTCGAACGTTTGGGTGCAGTCGATCAAAGCTGCTGCTTGCCGTCCCACGTCAATTCCAAGCGGTGCAGTAGCAGACGTCCGATCGCCAAT
GCTGTCGTCTTCACTGTGGCTCTGCGCAGTGACAAAACTGCAAACAGCCCGAGAAGAGATATGAGTCTCATGAGCCCCTCAGCTCTTGTATGTCGAGGAG
CGTTTGGTCCAGATTCGACAATGGTTCTGATGCTCTATTCTCGATCTGCGAGCAACCCAAGTCTATCTGCACCAAAATACGCGTACCCGTGAAACTGCAT
CTGTCACGCGTTCAATATCCGAGCTCCCTGTGTTCAACGAGTTATTCGTGAATTTGAAACATGGGACGGGAGCAAAGCGTCCTCTTCGAAAATAGTTGGC
GCTCATGTTGGAGCAAATCAAGTTGGAACAATTCACAACGAACTGGTACTATCGACGGAGGAGCCTTT