Description :
From Genome Similarity Track
Location :
Scaffold_812:5010- 6431
Transcript NameFunction/comments
Phyag_g8165hypothetical protein

Sequence
1421 bases(100 bases per row)
TTACCATGCGTCCGCCTCTCCCCAACTGCAATTCCTGTACGAGCATACTGCAAGTCCAACTCCAGATCCTCGTATTTGCACCTTAGGTCACGCTTCTCGG
CTTCCAGCTCTCCATTTAGCCGTAATAGTTCGGAGATGCGAATCTGAATCGCCTCTAGCTGCCGCATAAGGTCTTCATTGAGTGTTTTCATCTCACGATG
CTCTGCTTGCAACCGGATTTCCTTTTCTTTCGACCCTGTTGCTTTTGTAGCAGCCTCAAGCTGTCCCATGAGCAATCGTTCTCGTGTTTCTAACGCGTCC
ACTCGGCTTTTTAGGCGACCTACCTCACTTTGATTACCTCGTTGCTTGCCTAGGTCAAGCAGCGGTAGTTGGGTCTGCTTGTCCTCCAAGTttttctcca
gctgcttacggcgctgctgctcgactAGTATCTCATcttccagcgcgtccagACGCTTGCGGAAAGCCTCCCACTTCGTATTCCGGGAAGTCCAGTCGCG
CTCTTTTACTTGCCCTATCGCATTCTCCAGCGTGTAAACCTTGTCACTCGATTTCTCTCGGATTGCAGATAGTTCTTGCGCTTTTTTCTCCATTTCCAGC
TCAAGCCGTTGGTTCTTTAagagcgtctgctgctgtgtttcCGTCATTAGGTCGTACTGCACGAGGAATTGCTGATATGCACCCTTAATCTGCATCAACt
gatgctggagctcgccTACAATCGCGTGATCTTCCGATGAAGCGATCAATTCGCGtagctgctcttcttgctgctcacGGTTAccttgctcttgagcagc
gcgtttCGTCAATACATTGGCCTGAGACGCTGCTAGAGAAGCGATGTCCTTGTACTTTGCGCATTCAAGCGCAAGACCCTCATAGAGTTGCTCAACTTCG
CTGATCCTCTCGTAAAGGAGCGTGTTCTCGTTTCGCAACTCGGTGTCATTTCCAGGACCGCTCTTCCCTGCAGGTGCTTGCACTAACTCATCGTCGTGGA
GAAACATTTTATGCCCGGCTTCTTCAAGTTCTTTCACACGCTCCGTTCGCATTTGCAGCTCATTCTCTAATTGAGCAATGCGATCCTGAAAAATCCCTGG
ATCACAAACAGATTCTCCATCATCACCTCTAGCACTCTTTTCTGCCTGCAGTACCTTGAGATTGTGCTGCATTCGGCTGAGCTGCTCCGGTAAAGCGTAC
ATCTCCAGATATTTTGCATGCATCTCCGCGTAGCTTACACTCAGCCtgttgtacttcttcagTACGTCATCAATTGCACGCTGTTGCTTATCTGCAAAAT
CGCGCAGCACACTCTTCTCCAAAGCCTTTTCCATACGCTCTATCATCTCGTCAGCGCCCTGTTTCCATGTTTCGAGGTACAAAACTCGATATTTCAGCGT
TTTTTCCATCTCGCTCCACTC