Description :
From Genome Similarity Track
Location :
Scaffold_358:501- 2731
Sequence
2230 bases(100 bases per row)
CTCGGGTGGCCCGGCGTTAACATGGGAGCCGTATTCTTCGCTGTCGATCATGTTCTTGGTCTTAATCAGCGGGATTTGAACTTCGTGCGGTAATTGCGCC
GCGCCGTGAAACAGGTCCAACCGGATCCCCTGAGGGATCATAAAGTCGGTCCCGAGTACTACGTCGACGCCTGCACTATGCGCCATTACCCACATCTCGA
ACTCGTACACCATCTCCCATCCAAGCGTAATCTTGACGCACGCTCGTCGCGTCGTAGACACCTTGCCTTCGTTGATTCCTTGAATGTCAATGCGGCGTCC
GTGATCGGGTACATCTCGGAGTCGCAACTTCTTGGCAAAGGCGTCAGTGATCACACTAACGTTCGCTCCCGTGTCGAGGTGGATCCTCGTTCGCTGGTCG
TTCACAGCGCCTTGCACCAGACCTCTCATTCTGATCCGTCGGTCAAATTTCTTGGCCGACCACCACCCCTGTCTCTCGCCAGGGTTCAACTTCATCATCT
TGAAGTGACCCTTGGGCTCGTCTCGCGCTGCACTCGAAACCAAGCCGAACGAACCCTCGCTGGTGCCCTCATCAGCATCAGCAGTGTTCGTGTCCAGTCA
GGGGTGACCACGGAAACGACAGGTAACAGCACTGGATCAAGTGGAGTCACCTGTTTTGACGAGTTTGTCCCGGCCTTGTGTGCCACCAAATCTGCGAACG
AGACATCGGTGGTTGATCCAGAGGATGCAGGCATCGCGCGGAAGGTGTTGAGTACGGCACCGAGTGTTCATTGCGAGATTGGTGCGAATGCCGAACTGTC
AAGACAGCAGCCGACCGAGGAGCTGAACAAAAGTCAACAACCCAATATGTCGGTAGCCCGCGCATTCAATATTGCGAAAGACGACTCGGCAGATGGACCA
GAGATGGGAAACCAGGATGGGAAGGAGATGGACCCAGTACCGACTGTTGAAATCAAAGCGGATGCCGACGCTGAGACAAGAGAAGAGTCCGTAGCGACTT
CGGACAGAACGCATATCTCGGTTGCTCGAGTGTTAACGACTGAAGGAAATGAAGCAACGGAGGATACGAGAAATGTGATCTACGAACACCCAGTTAACAA
CATTGGCTTGGCAGACTACGCGAAGGAGCTGGCATTCCTGCCGGACCTGACCGAAGAGATCAACACGACAATTGACTACACTGCGCCTTATGTTGCTGAT
CCTGAGTTGTCGACTGATCGCCGAGAACGTCTGGTCGCGGCGCTGAAAGAACCACGAGCAGATTCTGACTGCTAGTGGCAACGCACTGCCGCCACCAGCC
TACGGCGCGGTATGCGATATCGACACACAGGGGCACGCTCCAATTAAACAGCGTGCCCGGCGCGTGCCGCTACGATTTCTCTGAAAATTGTACGAGCTGC
TGCGCGCTCTGTTGCGAGCAGGACTGATCGTCTTTTCAGATAGTCCATGGGCATCGCCGATCGTGATTGTGATGAAAAAGAACGGGCTGGACATCCGGCT
CTGCATTGATTACAAGATGGTGAATGCTATCACCGCGATCATGGAATATGCAATGCCGCTAGTCGATGACCTGCTAACAGATCTCGAGCGCTACCTATGG
TTCTGCTCGCTGGATGCAGCAAGCGGCTTCTGGGCGGTCATGATGACCTTGCGAGCACGTAAAGTATCGGCGTTCGTCTGCGCACTCGGACATTTCGAGT
GGTTACGCATGCCCTTCGGGTTAAAGAACGCGCCGATGATCTACCAGCGTATGATTGACAGCGCACTTTAAGGGTTCGTTCAACCTAAAGGAGGTTGGTT
TGAATACTCGGAGAAGATGCGTTTAGCTGAAGAACAGGCCAAGGAACGTCGTGGGCCAAGCACCGAGGGTTCGTTTCAAACGAAGTTCACGGCAGACCGC
GAAGCACCAGTAGAAACCGACCGTGTACTACAACTCGTCAACAGCCCCGTCGCTGACATGTTTACGAACGGGGAAACAGACGAATCATCGCTGGTACCTG
TGTTTGGTCGACGGTCGTTTGTGGATGATATTTGCTTCGGTGGCGAGGATTTCGACAGCTGCTTGGCGACGCTGGACCGATTGCTGGCAAGATTTGCACA
GTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTTCTGCCAACCCAAGGTGGACTTTCTGTCGCATAAAATTTTGCCAGAAGGTATCAGGGCTGATCCG
AAGAAGCTTGCGGCCATCGACGAGCTTTCG