Description :
From Genome Similarity Track
Location :
Scaffold_432:501- 2531
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_432-snap-gene-0.6NADPH-dependent diflavin oxidoreductase

Sequence
2030 bases(100 bases per row)
CCGCGCCTGCTGGTGCTTTACGGCAGCGAGACCGGCACGGCGCGAGATGTCGCTGAGTACGTGCAGCAACTGGCGTTCGCGCGCTGCCTTGTGGACACGC
AGGTGATTGCCATGGACGAGTTCCCAGTCGCACAGCTGCTCCCGCAGTGCGAGATCGTCGTGTTCATCGCTTCCACGACAGGTGATGGCGAAGCGCCAGA
GAACATGCGCGCGGCGTGGCGCAGTCTGTTGCGCAAGAACCTATCATCCGAGTGGCTGCGCGGCGTGCAGGTCACCGTGTTTGGTCTCGGTGACTCGAGC
TACGCCAAGTACAACGCTGTTGCGAGAAAGCTGCAGGCACGTCTTGTGCAACTCGGTGCAACGGAGATCGTCGAGCGCGGACTCGGCGACGACCAGCATG
CGTTCGGATACTTTGGTGCATTGAACCCGTGGCTGACCAAGTTGTGGAACGCTGTGCTGCAGAAGTACCCAGTACCTGCTGGCTTCAAGATCGACGACTC
GCCGCGACCAATCGAGCCAAAGTACAAAGTCGTCTTCCATGAAGACTCTGATGCTGCGACTGTTGCTGCTGCGCGGAACTTCAGCCCGCGAGACGACAAG
TCGAGTTTCTACGCGGCGCCAAGCACGGCTGTCAACGCAGACCAGGGTATTTACATGGCACCTGTGGTCGTGAACGAGCGGCTGACTGCAGAGGACTGGA
GCCAGGACGTGCGTCATCTCGAACTTGACATTAGCAGCGGCAGCACTGGCAGCATCCCTCCGTACAGCGCAGGAGCGATCGCGGACGTGTACCCTGAGAA
CACGTGGGGCGTCGACGAGATGCTCGGGTATGCGAATGCTTCGGGCGATGCCGGAGACCGCGTGATTTCGATTTTGTCAGCAGACGGCTCGGCGCAGTTC
GATCTTCCGTCGCCGACCACCGTGCGCGATGTGTTTACAAAGTACCTGGACATCCTGGGTACGCCACGCCGCAGTTTTTTTGCGAAGCTGTCGCTCTTTG
CGACCGACCCGGAGGAGAAAGAAAAACTCGAAGAGCTCGCGTCGCCCGAAGGTGTGGATTTGCTCTACGACTACTGCATTCGCGAGAAGAAGACGTACTC
GGAGGTATTGTTAGACTTTCGAAGCGCGAAAGTACCGCTCGCGATCTTGCTCCAGCTCATCCCATTGCTGCGGCCGCGCTCATACTCGATCTCGTCTTCG
CCGCTGCTGCATCCTGGTCGAGTGAGTTTCTTTTTCTATTCGGGTACATCACATAATTAAGTTCTGAGCTGACTGATCTATACTGTTGCTTATCTCTCCA
CTCAGGCGCACTTGACTGTGGCGATTGTGGACTTCCTGACGCCCTACAAGCGCCGTCGATTGGGTATCTGCTCGCTGTTTCTCAAGGCACTCGATCCTCA
AAAGGAGCGGCGAATCGTACCGATGTGGATCAAGACCGGGCTGTTCAATCTGCCGAGTCGAGCCAGCCACATGCTCTTGGTTGGTCCAGGCACCGGACTC
GCTGCGATGCGCGCGATCATCCAAGAACGGAAAGTGCTTCGAGCCACTGGAGCGGTTGCTGACGGCGATGCTGCGCTCGGCCACACGTATCTGTACTTTG
GCTCTCGCCACAAGGAGAAGGTGTGCATATGCGTCTGCTTTGATGTTGTTTCACTCTCCATGACGTTCTATCTAACTCATTTCCTATTGACTTTACTTTG
TAGGACTTTCTATATGGAGACGAGATGCAGAGCCTAGTGCAGTCGCAGGATCTCACGGGTCTCCACACGGCGTTCTCGCGCGACCAGAGCCACAAGATTT
ACGTGCAGACGCGACTTGCCGAGAACAAGGACGAGGTTTTTGCATTCCTCGTGAACGGCGGCTACGTGTACATCGCCGGGTCTGCGAAGCGCATGCCCAG
CGACGTGTACGAAGTGCTGCGCGACATTCTGCGCTCGGTGGGCGGCATGCCGCTGAAAAACGCCGAGGCGTTCATGAAGGCCATGGTGCGCTCGAAGCGG
TATGTCGTTGAGTCGTGGTCGTGAGTGACT