Description :
From Genome Similarity Track
Location :
Scaffold_4533:501- 1962
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4533-snap-gene-0.1DEAD/DEAH box RNA helicase

Sequence
1461 bases(100 bases per row)
CGCGAGCTTCTCGCGCTCGTTGGTCTCGTCGTCCGAGGCGTCCTCCATGGCGTAGACCCGGTCGAGCACGCCCGTGTGGTCCTTCTCGCCCTTGGTGGCC
TCCTTGCGGATGATCTTACCGTGCAGCTTGCGCTTGCCCTGCATCATGACCACGACGGCCGAGTTCTTCTTGGCAGCGTGCGTGCCGCTCGCGATCTCAA
AGATCGTCTGCGGCGGCCGGAAGCTCTGCAGCGACTCAATGTACTCGACCTTCTCGGCCTTCGAGTCCTCCTTCATGTACGCCTCCATGAACAGCGGGTG
GATCTTCTTCGCGAGCACGTCCTTGGCGCGCTTGATCGAGAGCTTGGACGGGTCCGCACGCGTGCGTGAGTACGCCTTGTACGAGTTCTCGCACACCTTG
ACGAGCGGCGAGACGTTCGGGTGGTTCTTCATCACGTCCGCCATGTGCTCCGTCTCCTGGTCGATCAGCTCGTTCGGGAACGCACCGTAGTGGATATCCG
CCACCTGCATCGTCTCGAGCGAGTATGGCGTCACACCCACAGGCGTCGAGTCTTCCAGGCGCCGACCAATGTACAGGTGCAGGTCCACCATGAACGGCAG
CTCGTCCGGGTCCACAAAGTTGAACGCCGTGCCGCTGCGGCCCGCACGCGCAGCGCGCCCCACTCGATGCACAAAGAGCTTGGCGGTCGACGGGAACGAG
TAGTTGAGCACGTTGTTAAGCAGCGGGATGTCGATACCACGCGCAGCCACGTCCGTCACGATGAGCAGGTTGGTCTTCTTGGCGCGGAACTTGCCAATGT
TGATCTTGCGCGACGCCTGGTCCATGTCGCCGTACACGCACGACGACTCGATGTGGTTGGCCCGCAGCAGCTCGTGCAAGAGCTCCACGTGGTGCCGTGT
GGCGGCAAACACGATCGTCTGGTCGTCCTTCGGGATGAACTCGCGGACCATGTACAAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGT
ACTCGACGACCTTGAGGTTGAAGTCCGGGATTTCCTGTAGGTGGTGCATGAGACGACCGGGCGTCGCGACGATGATGTCTGGGTTGGACGCGATCGACTC
AAACTGCTGCTCCATGCCTTCGCCACCGACAATGAGCGTGATCTTGAGGTTCATGAACTTG