Description :
From Genome Similarity Track
Location :
Scaffold_261:501- 1638
Transcript NameFunction/comments
Phyca_LT1534132911Putative AC transposase, partial

Sequence
1137 bases(100 bases per row)
ggagggcgggttaatttcttgtcggatgtttggatgaatatgtccaagacacactgcttggttgccagttaacgctgtacgggaacgtttgtgcacctgg
gttatattctacaaaccacaggcacgatggcgtagccattgtcgagcaaatagagaaaatcttgcttgaaattgaggccaagggctgggtcattggggca
gtcgtaacggatgatgccggtcaatgcgcacgtgctcggcgtatactagatcttcgttggccaaaagtggtgttcgtgcgctgcttcgcgcacgccgtgg
tcaaagcagtgctaaattcagcttttcggcgcgtgacagctaaggcatcggatgtggtgaaaacgctgaatgcctcttcttcaaagtggctaccgttggc
ggataaggcaatgaatcaaacgtatggagctactaggaaacttatcccactctgtacaacacggtggaatacaatgcagttctgcttcgcttcacttctg
cgagtccgcacggcgttaagcattttcgaagtgacgaacaagaacgcacatgattttccagagaagttgagagaagacgcagggttttggtcagagcttg
aaaaagctgaagaagcgattcgctcactgtgttttgcctccttcatgctccaaagcgataacaacacgcttgcggatgtcgtgttgtgttttcgagagct
atacgataagttcatcgctagctcgataagtgacgagctgcttgagctgctgggaaaacgctggaacgattgcgagcagcctctctttctcttagcgttt
gtgctccacccttgtaataaagagttgatgaaggagctttctgggtcagtggcgaatttgatgggttaattcgctttggcgtactataggaaactgtttg
atcaggatgcgcagtcaattgtcggtgaaatgtccgagtggatgcgaggagcgtacacaccgttttcttatcaatttcgataatttatcaacgccagagt
ttgacaggaagcaaagtcgtcaaaaaaaaagagatctcatctggggtctgagctcgccgaactggcgctggttgtgttggctgtggctgtaaatacagcc
acctgctaacgatacttctcagagttggcgctcattc