Description :
From Genome Similarity Track
Location :
Scaffold_2624:501- 1575
Transcript NameFunction/comments
Phyta_totarag14685ATP-binding Cassette (ABC) superfamily

Sequence
1074 bases(100 bases per row)
TCGTGGTTTTCATCAGTGCCCCTGACACGTGGTCGTCGAGAGCACACGTGAACGGACTGGCATTGGGCTTCGGATCCTTTGTACTCTTTGCCGCATACGC
ACTGGCATTTTGGTATGGTGGCAAGCTGGTGGAAGACGGCGATATCACGTTCAAGGAGCTGATGCGAACCCTCATGGCCATCATGATGTCCGCGCAAGGT
ATTGGAATGGCGTCGACGTTCCTCGCCGATTCGGATCACGCTCTGAAGGCTGGTAAGGCAATTGTGGACCTCCGCGATCGTGAACCACCGATCGACTCCT
TCGATGAGTCCGGATTGAGACCTGCTCACCTTGAAGGCAAGATCGAGTTCAAGAATGCAAAGTTCCGATACCCTTCACGACCTGAAGTCACCGTGCTACG
AAACTACAACCTCATCATCGAAGCTGGACAGACCGTCGCATTCTGTGGACCGAGTGGAGGAGGCAAGAGTACGGGTGTATCGCTAATCGAGAGGTTCTAT
GACCCTGTAGACGGacaagttcttcttgacggcgtcgacaCGAAGGAGCTCAACCTGAACTGGCTGCGCAGTCAGATCGGTCTGGTCGGACAGGAACCCA
CGCTCTTCATCGGCACCATCGCTGAGAACATCGCGTACGGACTCACGGACAAACCCACTCAACAAGAcatcgaagaagctgccaagATGGCCAACGCACA
CGGCTTCATCACCAAATTCCCAGATGGCTACAACACGCAGGTGGGGATGAAGGGCGAGCAGTTGTCGGGTGGCCAGAAGCAACGCATCGCCATTGCGCGT
GCTATCCTGAAGAACCCGAACAtcttgttgctggacgaggcgaCGAGTGCTCTGGACTCGGAaagcgagaaggtggtgcaggaggctctggacaaggtgg
tggcgttGAAGCGGCGCACGACGATCATCATCGCGCACCGTTTGTCTACGATTCGCAAGGCAGACAAGATCTGCGTGGTGAGTGGTGGGAAGATCGCGGA
GCAGGGCAGGCACCAGGAGTTGATTAAGCAGAAGGGTATCTACGCGAGACTCGTGGAAAAGGCAACTTCGTAGG