Description :
From Genome Similarity Track
Location :
Scaffold_72:50094- 51860
Transcript NameFunction/comments
Hyaar_Emoy2807965hypothetical protein

Sequence
1766 bases(100 bases per row)
ACTCTCTGATTAGTTATAAATATAGCCTTTGTCCGATTTGACTCGCTAATAAAGGTTTTATATCACCACGCTCACCCAATTGGTCAATTCGGTCAATACT
TTTTTCAAGCGCGGTCGGAGTTTTAATGTTATATTTTGGGGAGATGAAAATGGCCCATTTTTTGTCACGAAAATAAAATATGCCCCAGGTAATTAGAAAA
ATGCCCCACGTCCTTGTATACTCAAGTTAACGTGGTACACATAAAAATTATGATCTTTAGTCAAATCGCGATTCCCATTGTACGGCTGTGCTCGACCCCC
TCCCTGTAGGGGGAGACGCAGAGGGGTTCTGCCGCGGGCGTGCTGCACACCCATCCACCAATTGTGGGCGCGAACGGCACAGTAAGATGTGAAAGCGTCT
CTGTATCGTCGGCCGCGGCCGCAAAGGTAGACAACCGGTGCTGATGTCGTTACAATTAATAGCATTGTTTTCTATCGTTTTTATTAATGTTGTTATTGTT
TCTAATGTTATAATTGGTACTATTGCTATTTTGGGTCAGTTGCTCATGTCATTGTTACTGCTACCGCCGCCGCTATAGCCGTTGTTGGTGTAAGTTTTGT
ATGATGTTCCTGTTGCTTTTGTTCTGCTGCTGATGCTGCTGCTGGTGTTGCTGACGTCATTGTTATTGTTATTGTTCTTGTCGTTGCTTCTGTTGCTGCT
GTTGGTACTGGTGTAGCTGTTAATTTTGCTGCTGCTACTGCTCCTTTGCTACTACTGCTCTTGCTACTGATGTTAGTGTTAGTGGTGTTAGTATTGTTTT
GTGATGTTTTCGGTACCGCAGTGCTGCTGTTATAGTTGGTTTGGTTTTGGGATAGGAAATTCCTTTCTGCTCGAATGCTATAGTAACACAAAGCATATTT
AACCATTAAATAGACTATAATGAATCCATTCTATCTGTTTGACTCTCATTTTACTAATTTAAAGGCTTTACCAGTGCTGATGGCGACACTTCAATGCTGT
TGCAGGGATTGGTTGGTGATGTTAATGATTTTAAACTTAAAGGATAGCACCTTGGACGTGGAGAGTTCTTGGGGGAAAGAAAGTCAGACGTATCAGCACA
TTGCGTGTGAATGGTGATTATTGCGAGCCCGAAATATGAAGCTATTAGTGAGTGTGCGCAAGGTTGAATACCGAACTTTTAAATCGTACTTACCTGTGCG
TGTGTCTGTCTGTTTGTAGATAACGCGGTTAGGTGTACCTTTCACGTACTAAGTGCGAGCTAGCCTGTCCCCCCCCCGTAGGTATAGGTATATCCGAAGT
CACTCTTTGGCTTATTCGAAGTCACTCTTTGGCTTATCCGAAGTCACTCTTTGTTTATGGAAGGGGAAGGGCTGGCTTTCAGGGGCTAGATGCCATGCAT
TGCTATCATTAGGCCCCTGAGTGGTACCAACGTACATCTGGGTACCTTGAGAATCGACAACTCGACGGGGCTCTACATCACCGCATCCGCTAGACGGTGA
ATGCCAAGTAAAAGGCGAGATGGAAGATCCAGCATACTCATCTTCATAACGCAACATACTCCGGTTGTGCCCATGTTTCTGACTACCTGCTCAAGTCCCA
TTTGTAAGCTCGTATTCCCACACCCAATAGACTCGTGAGACCAAAGGTGTCAAACTAATGAGTCCCGATTGACCGGCAAGACTGTCTCTCAGATCTGAGC
TCAAATTGAACGCAATCACCCGATCCAACACGATGACCCCCCCTCGTGAATCTNNNNNNNNNNNNN