Description :
From Genome Similarity Track
Location :
Scaffold_526:5008- 9014
Sequence
4006 bases(100 bases per row)
CTCCACCACAATGGTGCGCGTGCCCGGATCTACTAGTCCGAAAGGGGACGTGAAGGTGAAGGTTGAGGTGAGGGAAGACGGAACTCCGCTGGGACCGGCG
GAAGTTAAACGTGAAAACACTAGGTCCACCGACGGACAGGCAATAGGGACGCCTGAGCCGAAGGATTTCGTTTACGAAGAAGTTCCCCGTTAAGGCTCCG
AAAGGAGCCGTCCAGGACTCGGTCCAAAAACCGAGTTCCATTGGTCCTGCTGCTAAGCGGGACCCCGGCGTCGCTGAAAAGCGAGCTCGAAACCTGGAGC
GCGAGCATCTGAAGGGGGTCATCCGCGACCCCGCTGCCCGAAGCGATGCTCTAGACGCTGCGATGGACTTCATGGAAGTCGAAGATGCGAAGAAGAAAGC
CGAGAAGAAAACGGTGAAATTGAAGATCTCGGCGCTAGCGGTCCATGGCCCCAGCAACGACACTCACGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTGCAAACTTGAAGATCCATGATGGCACCAAGGAACAACGACGTGAACACGTCGACCACTTCATCGATACAGTCCAAGATGACGA
TCTCGCCGGATCTCTGGTAGTGTTGAGGCTGCCTGACTCAGAAGCTCTCGAAGGCGTCCTGTTGGCCATGCGACGCCGCCACCAACGTCGCAAGATTGAG
ACCCAAGGTTCGAAATACCGCCAAAAGGCTCCCGCCCCTGCAGCCTCCTCGAGGGCGGTGCGGGTTGTGACTACCGGTCGCGGACGCCGCGGAGATCACG
GAGATCTCAACGAGTTCGAGGGCGCATCAAGCAGTTCCGATAACGAATCTGAAGACGAAAGAGCGCACGTGTTTTCGGCAGCTAGGACGCCTACACCAGG
AGATGGTGAACAGCCAGGGGCGCGCCAAGACCGCGAAGACCAACTGGGGCGCCCGAAGTACGGCACTCGATGCTCACACTGCGGATCTCGCAAGCATACG
GATCTCGGGTGCTGGAAGAGGCTCACGTGGCAGAAGTGTGGACGCATGGGCCATCCTACCGACAAGTGCTTCTACGTCTGCAAGTGCTGTGGAGACGTTC
ACGAAGCAGGTCAGTGTAAAATCGGCGACTTCTTCGATGCTGTTCGCCAATGGTACAACCCGACTCGCCATGCCAGACTGCTGCCCGAGAGCGTCGAGAA
GGCGTTAAACTAGACCGCTCGCCAGGCCTGAACAGCCTGGTACGTGACGAGCGATCGAAGTTCTGCATTTATGCATATGTTCAGAGGAAGGCGCGAGCGT
TAGAAGACCCAACTTCCTGTAATGCGGTGAATACAGCTAGATCTCTTACCTCGGATGAAGATGACTATTCGCGTCGCCCTTGTGTGATGGCCCTTCGACT
GTCGCCGGGTGAACGCCGAGGTTACTGGAAGTATTACACTCCCTCCAAGTGGTTCAAGCAGTCGAAGGCGACCGGTGCGGTCAACAATGTCCGTGCCGTC
CTACTCTTTGATACTGGAGCCGAAGTGTCGATAATCGACTCTACCTTTGCTCAAGCTCACTCTGGCTGGAGAGTTGGTGTACAAGTTCCGCGTGTGGGTT
GGAGATCTCTCAGGACAAGACGTCATTCTCGGCATGGATTTTATGGTTCCTGCGGGGGTGAGGTTGGACCTGGCTGACGGAACGCTCTGTCTGCCGGACG
AAGTTCGCATCCAGATGACCGACCGTAAGCCACTGTATAGCAGCAAGGCTGACGCGGTCTACGCAACGGGATTCCATGAAGTCGGTCCTGGCCAATGGAC
AGAGATCTCACTCGAGTCCCACAACAAGCGGTTTGAACTGTGGGTAACGAGAGGGGGAAAATGGGTGATCACGGTGGTGAATGGTGGATTCGGTAACAAG
TCATACCTCCGGATCACCAACATCAGCACGAGCCGCCTGGTACTGGATGGTTTGGTGTGTTTGGCAATCTGGTTACCCGTTGGGCAGATCCCGCGTCGAC
CTGGATTCGCTAGGAAGGATTTAAACCGCTATCGGGAGTGGCAAACACTTGCGTTCGAAGCAACTGTGGACACTGGAGATGCAAACGAAGCGGAAGTTGA
AGAGTCTCGACCGCTGGTCGAGCGTCCTAGCTACCGGACTCCGACTGCGATTTTAGCACGGCCTCCACAAGTGCAGACCGTTGAAGCAGCAGCAACATCA
GAAGAATGCACGCGACTCACACTGGACGACACACATCCTCAAATGCAGCTGATGAAAAGTTCGACTGATCCGACTAGGGTGACCGAAACCGACGAGGACG
TGATCTCTACCGATCCCGATCAGGTGATCTCTGGTATGGACAGCGATGACTCCAGTCTACCGCGTACGGAAACTCACGCAGGCGAGGAGAGCGGCCTATG
CCTTACGAACAGTGGCGAAACACTGGTAGGCTTGGCGTCGACTCCGGCAAACGTGGCTGAGTCCGAGCTCCGCAAGGAGTTCCCAGAATATACCCCTGAC
CTCATGCCACAATCCAAAATACACGCCGCGGCCACCGAGGAAATGGTTCATCGCACGTTGTCGGTCATCGTTGAAAGCGACTGGGGCGACAGCTGTAGCT
GTGCGTTCGAAGCGCTGAGTCTACTGGTAGCTGGGGTAGTTTTGACTGGCAGACCGACGACGAGAAAGAAGAGAAGCCGGTGAGCGGAATGCTCCCAGTG
ACCCAGGTCGAACCAAGCCAAGGCGGAGATGCAACCGACATGAATGAAGCGAAGTATGTTCATGAAGGGGCCGATCTCACTGCGGAAGAAATCGAAAAGG
AGATGGCGGTGTTACCAGAGATCTCCCTGACGGCAGAAGTTAAAAGAGAAGATCTCAAGGTCGGGGATCCAACTGAGAACACAGCAGAGGAGATTGATCG
TCTGCGTGATATCATTTGGGAGCGACGTCACCTTCTCATCGGCAAAGGGAATGCTTTACCCCCTGCGGCGACGGGGGCGATCTGTGACATCGACGTTGGT
GGTGCA