Description :
From Genome Similarity Track
Location :
contig_9:500700- 501975
Transcript NameFunction/comments
g2669.t1hypothetical protein

Sequence
1275 bases(100 bases per row)
GAGGGCGGCGCTATCCGTGAAGGTGGCATGCCCGTACTGACCAGCAAGGAGAACCTCGGTCTGCTTTTCGAATATGCCACAGTCGGGCTAGTGTATGGCC
TGCTGCCGGCAACCATCTACCCGTTCATGCAACAGTACTTGAATTGTTCAGGCTCCCAAGTCACTGCAGCTCAGCAGCTTGTCGTGCTACCCTGGAGTTT
CAAGGTCTTCTACGGCATCCTGTCCGACTGTCGTCCGATCTGCGGCTACCGTCGTCGCCCCTACATGCTCATCGGCTGGGGTATCTGCTTCATCATGCTG
CTGGTGATGTGCATTATGCCTATCGGCAAGCCGTACTTCACAGACGCTACGGATCGGGACGTCGAATTGGAGGATTACACCCCAGAGCTCGAAGCGCGAA
TCAACTACGACGCTCCGTCGGAAGGTGCCAAGTACGTCATGCTGATGTTCTTCGCCGCTGTCGGCTACGTCATGTCGGACGTGTGCGCCGACAGTATCAC
GGTCGAGCTGGCTCAACGTGAGCCCATTGACAAGCGAGGCAAGACGCAGTCATGCATCTACACAGTCCGTACCGTTTTGGTCATCTTCGGTGAACTTCTT
ACGGGATTCTTCTTCAATGGTGAAGACTACGGCGGCGACTTCGACTTCTCTCTCAGCTTTCCTCAGCTCATGATCATCGTGGCGGTGCTAATGCTACCTG
TCTTTCCGACGACTTGGTTCTTCATTAAAAGAGGAGAAGAAAGAGGCTGCTAACTTCAAGGAGTACATCGCCAGCTTCTGGGACCTCTTGACCACGCGCG
CAGTGTACCAAGTCATCGCGTACAACTTCTTCTCACATATTTTCGCCGACATCGCGTACACCGGCAGTTCGCCAGTGCAACGTTTCATGGTGGGTGTCAC
TCCGATCAACAGCACGCTGAGCGACATCCTCAGCAACTTGCTCTTCATGTTTGGTATCATGATCACGTCCAAGTGGGGACTCCACTGGAACTGGCGCTGG
ATGATCGTCGTTACTGGAGCGGTGGTGATTGTAGTCGACTGTGCCGTGTCGATGATCGTTATCTGGGACGTGTTCCGCAACCAGTGGTTCTGGCTGGGTC
CTCCTATCGCCGTGCAGCTCCCGTACGGCGTCGGCTGGATCATTTCGACGTTCGTGACTGTCGAGTTGGCCGGACTGGGCAACGAAGCCGCCGTTTACGG
TTTGATCACCACCGTGACCAACGTCGCCGCTCCGTTCGCCTCTGCGTTGACGCTCGTGATCGACGCCCCGTTCAA