Description :
From Genome Similarity Track
Location :
contig_9:500656- 501931
Transcript NameFunction/comments
g2814.t1RAW24500.1 hypothetical protein PC110_g19072 [Phytophthora cactorum

Sequence
1275 bases(100 bases per row)
GAGGGCGGCGCTATCCGTGAAGGTGGCATGCCCGTACTGACCAGCAAGGAGAACCTCGGTCTGCTTTTCGAATATGCCACAGTCGGGCTAGTGTATGGCC
TGCTGCCGGCAACCATCTACCCGTTCATGCAACAGTACTTGAATTGTTCAGGCTCCCAAGTCACTGCAGCTCAGCAGCTTGTCGTGCTACCCTGGAGTTT
CAAGGTCTTCTACGGCATCCTGTCCGACTGTCGTCCGATCTGCGGCTACCGTCGTCGTCCCTACATGCTCATCGGTTGGGGTATCTGCTTCATCATGCTG
CTGGTGATGTGCATTATGCCTATCGGCAAGCCGTACTTCACAGACGCTACGGATCGGGACGTCGAATTGGAGGATTACACCCCAGAGCTCGAAGCGCGAA
TCAACTACGACGCTCCGTCGGAAGGTGCCAAGTACGTCATGCTGATGTTCTTCGCCGCTGTCGGCTACGTCATGTCGGACGTGTGCGCCGACAGTATCAC
GGTCGAGCTGGCTCAACGTGAGCCCATTGACAAGCGAGGCAAGACGCAGTCATGCATCTACACAGTCCGTACCGTTTTGGTCATCTTCGGTGAACTTCTT
ACGGGATTCTTCTTCAATGGTGAAGACTACGGCGGCGACTTCGACTTCTCTCTCAGCTTTCCTCAGCTCATGATCATCGTGGCGGTGCTAATGCTACCTG
TCTTTCCGACGACTTGGTTCTTCATTAAAAGAGGAGAAGAAAGAGGCTGCTAACTTCAAGGAGTACATCGCCAGCTTCTGGGACCTCTTGACCACGCGCG
CAGTGTACCAAGTCATCGCGTACAACTTCTTCTCACATATTTTCGCCGACATCGCGTACACCGGCAGTTCGCCAGTGCAACGTTTCATGGTGGGTGTCAC
TCCGATCAACAGCACGCTGAGCGACATCCTCAGCAACTTGCTCTTCATGTTTGGTATCATGATCACGTCCAAGTGGGGACTCCACTGGAACTGGCGCTGG
ATGATCGTCGTTACTGGAGCGGTGGTGATTGTAGTCGACTGTGCCGTGTCGATGATCGTTATCTGGGACGTGTTCCGCAACCAGTGGTTCTGGCTGGGTC
CTCCTATCGCCGTGCAGCTCCCGTACGGCGTCGGCTGGATCATTTCGACGTTCGTGACTGTCGAGTTGGCCGGACTGGGCAACGAAGCCGCCGTTTACGG
TTTGATCACCACCGTGACCAACGTCGCTTCTCCGTTCGCCTCTGCGTTGACGCTCGTGATCGACGCCCCGTTCAA