Description :
From Genome Similarity Track
Location :
contig_115:50043- 54891
Transcript NameFunction/comments
g13813.t1hypothetical protein

Sequence
4848 bases(100 bases per row)
TCGACCTCGGTATGACCTGCCGACCAAAATCCTGCGACGTGATCATGAAGGATCAAAACCCGTGGTGGCTTCGGTGCTCCCATCTTCCTTAACGGGGGCG
ATCGCTGGTACGGACTCAGCTGAGGAAGTGCGAATTGGTGAGCCTAGGACTCCAGAAGACGAAGAGGTGTGTTTCCATGAAGGTGGTGCCTTGTTTGCGG
AAGACGTTGAAAGCCAGATGGCTATCCTACCCGAATTGCCGATCACTACCGACGAAGTCACGATCGAAGACATTCGAGTAGGTGATCCGGAAACGAATAC
ACCTGAGGAGATCGATCGACTTCGCCAGATCATCTGGCGGCGACGACACTTGCTGATCGGTAAAGGGAATGCCCTTCCACCCGCTGCGATTGGTGCGGTG
TGCGACATCGACGTTGGGGGAGCCGCTCCCATCGCCCAACGCGTGCGGAGGGTGGCCCCTCAATTCCGAGAGAAACTGTCTGATCTGATCAAGAGTTTGT
TGTCCGCGAAAATGATTGAGCCATCAACTTCACCATGGGCATCCCCGATCGTGATCATCATCAAGAAGAATGGAGTCGACATCCGGCTGTGCATCGACTA
CCGTTTGGTGAATAGCCTGACCAGGTTGATGGTATATCCCATGCCGCTGATCAACGATCTCTTGGAGGACTTGGACAAAGTACTCTGGTACTGCTCTTTG
GATATGGCTAGTGGTTTTTGGGTGGTCTCCATGACGGAACGTGCGCGAAAGATCTCCGCGTTCGTTACGCCTTTCGGACTCTTCGAGTGGACGCGTATGC
CCTTCGGGCTGAAGAACGCCCCACAAATCTACCAGAGGCTGATCGATAATGCTCTGTACGGATACCTCCGGATAAGTCCTGATCGAGACCACACGGAACC
AGCCGACGTGTTCGAGAAAGGGGAACCCGAGGCACACCCGGGTCCTTCGGTGCTGGGCAGGCGATCGTACATCGACGATATCCTGATCACCGCTGACACC
TGGGACTCGATCTGCGAGACGGGTCGAGGCATTGCTTGACGCTTGCGAGCGATGGAATCTGTCGATCAGCGTGGTTAAGAGTTTCTGGGGACATCGGAAG
GTGGAGTACTTGGGTCATCGGGTATCGGCCGATGGTTTGGAAGCCAATCCGAAAGATCTGGAATCGCTGGAGAAGCTGCCGTTTCCGAAGACGTTGCGAT
CGATGCAGTCCTTCTTAGGAAGCCTGAATTATTACAGTCGCTTCATTGAAGACTTCGCCGTTTACGCTGCGATCTTATACGAACTGCGAGAAGTGGACTT
TTACGAGATGCACCACGGGAAGCATGAGGACCGAGCAACGGAGTCCGATGATCGGTGGACTAGAGCGAGGACGGCGTTCGATCTACTGAAGGCCAAGCTT
GCGACCACCCCGATTTTGCGACACTTCGATTCCGATTGCCAGCCTGTGATCGTGGTCTACGCCAACAAGTGGGCTATCTCAGCTGCGTTGGTTCAGGAAC
ATGATGGCATGTATTGGCCTGTGATCTTTACCAGTCGTACGCTGAAGTCGAACGAGTTGAATTACAGCATAGTGGACAAGGAAGTTTTGGCGCTCCTCCG
GATCTTGGACGTGTGTTACACAGTCCTGACCAACCGATCGATCAAGGTGCTGTCGAGGTATTCGACGCTCGCCTGGTTGCTGAATGCGTCGGGCTTCCAG
GGACGATTGGGACGATGGGCAGCTCTGCTGTCCGAGTGGACCTTGGAGATCCGGAAGTGCTTGAAAGGAGAGGACGAAATCCTGGGCGCGATCGCCGCCA
GCATTACACCCCGAGCGGAAGTGGACGAGGCCTTGATCGCGATTGCACCGGTGAAAGAGCCCAAACGAACGATCGCGATGGCGCCGCCGACGGTAGAGCT
GGATGAAGAGTTGCTCGTCGTCAGTTTTGATGGGTCAGCACGCGTCAAGCGGAGCGCCGGAGCGTATAGTGCAATTGTCTGGAAGCTCCCGGAGTGGTCG
ATCACATCTGCCGCGTCCGAATTCGCCGACGACCTGACTGTCAACGAAGCCGAATATCGCGGACTTCTGCTAGGCTTCAAATTACTGTCCGATCAGAACA
GGGGGCGAGTTGTGATCTGCGGAGATGCCAATCTGATCATCCGACAGATGCGTGGTGAAATCGATTGCAAGGCACCGGGTCTCCAGATACTACGTCAGAA
AGCGATGGATCAAGTGAAAGCCTGGCCGAAGCACGAATTCCTCCATGTGAAGCGCGATTGGAATCAGAGCGCCGATCGGTTGGCAAGTGCGGCACTGCAA
CGAGAAGCAGGCGTGATCGTAACTGATGCAAGAAGAGATCGTCCAACGCATGAGGAGTGAGAGGTTAGTACAAGCCCAGGATGAAGAGAAGTGTATCGTG
GACCTGAAGTCGTACCGGCGGGGCGACGTAGCAGCCTTGACTACCAGGGATGCAAAAGCGTGCGCCAAGATCGCTGGAGATTACGAAGTGGGGGAAGACG
GCCTGCTGTTCTACTGTGTGAACACCACCCGGTTAGACGAGGACCGAGATTCGATCGCGCGTCTGGTGGTACCTGCAACGTTACACCAAGATTTCCTTCA
CCATTAATCATGCCAGCCTTGAAGGAGGGCACCAGGGAATCGGGAGGACGTACCAACGGATCAAAGCGCACTTCCACTGGCGGGGGCTGTTCAAGAGTGT
CCAGCAGTTTGTGGGTGAATGCGTGGATTGCGAGACAGGGAAGAGGCGCCCCGTGGTTCAAGGAGAATCACCTGGGAATGTACGGGCCACCCACCCCTTC
CAAATCATCGCGATGGACAATCCCATCTCTGCCAAAATCGTTCAAGGGCAACACGGAGCTTCTCGTGTGGGTCGATCTGTTCTCAGGGTACGTGATCGCT
AAGGCCGGCGCGTCTCGGACAGCGCAGACCATCGCGGAGAACTACGAGGAATGTGTTTTCCGCCGCTTCGGAGCCAGTGAAGCGATCCGACATGATCGGG
AGCCCGGTTTTATGTCTGATTTCTTCCGCGCATTCAGCCGTATAGTGGGACAACGACAACGAGCCACCATGGCCTATCGACCACAGGCAAAACGGTACCG
CTGAGCGATGGTGCAAACGCTTACTCGCGCTTTGAAGATGTATGTCGCCGATGTGAACCAACAAGACTGGGACGAATACGCGGAACGCCTGACTTTCGCG
ATCAACACTGCTCACGATCGAGTACGAGGAGAGGACGCCGTTTTACCTTGTCCATGGCTGGACCCACGATCGACATTGGAAGCGTCGCTGCCGTTAGGCA
GCACGCGACGTCGCGATCGCGACTCACGCAGATGGAGATATCGTATCCAGCAACAGTACCAGCGAGCTCGCGAGGAGGTCAACGTGCGCCTGAAAGAGGC
GATCCAAACGAGAGCCGGTCGCCACAACGACGGGAAAAGGCCGCACCAGATTGAGGCCGGGTCACAAGTGTGGCTATATTTGGATCGAGTTAAGGAGGGC
TATGCCCGAAAGCTGGCACACAAGTGGCACGGACCGTTCCGGGTGCGCGAGATGATTGGCCCCTACGCGGCCCGACTAGAGGTGGCCGGCACCGAGTATC
GTCTTTTTCCAATTGTACACGTCTCGAAGCTCAAGGCCGTGAAGGTTTTCTCTGATCGCCCTGACGTGACGCTAGCAACGGACGAGAATGGTCGATTTGA
TTTTGATGAGGCGTTGTTACCGGAGGACAGCTGGGAAGGTGATCGGAGTGATGACGAGTTTGAAGTGGAGCGATCACAGATGTCCGATCGGGCCGTAGAC
CAGATATGACGCGTCCATCGGGAATTCCAGGTCTTCTGGAAGGGGTACACCGAACGTCTTGGGTCGACGAGGCTGACTCAACTGCGGGCTTTGATGCACG
AGTTTGAGCGCGAGCGTACTAGACGAATGGCTTCGGAGTGATGCAATCGCACGAGGCAGAGGAGGACAACTCGTAGTGATCGCTGCGAGTTGGGAGTGAA
ATGGGTGCAGGGTGGCTGCACTTAGGAGAAGGAGGGCAACTCGTGGCGATCGCTGCGAGTTGAGAGTGAATTGGGTGCAGGGCGGCTGCACTCAGAAAGA
AGGAGGAGGTATATGTACAAAAAACAAGTGGCGTGAAGGGGGAGAGAACCGATTACGAGGTTCGATCGACCCGATCAAGGAAGACAACTGGAGAAAAGAG
GTGAAAATGGAATTACATGCAGACTAACACTCAAGTGTACGCTTAAGGGGAAGCTGGGATGACGAATTTGCTACGAAGACGCGTAATGCGTTGCGCGGGA
TGCGATCGGATGTCGTGGCGGTATTGGACCCGCCAGGGCTCAGCCAAGTCCGCCTCTTGGACTGCGGTGATCAGATTCGTCGCCTGCGAGTTGCCATGCT
GCCCTGGATACCACATCTTCTCCTCCACCCGGCCGAGGTCGGTGCATGAAGAAAGGATCGAGCAGAATGTCCAAATCACACCGACCCTCAACCAGTCCAC
GCAAGATCGTCCGAAGAAAAACTCCAGCGAGCACCGAATCGTGATTGCCGCTGTTTTCGGTAGCGGCGAGAGTATCCAGGTAAACGTCCCCGCGACGACT
GCTGGTGCTGATGGAGAAGTAGTGCAACGACTCCCACACGGCCTGCTCGTGTATCAGGTCCGCATATTGACGAGCCATGGTTGCAAACCAACCCACGAAC
ACGAACGAAATCGGAGTAACGGCAGTGTGGAAGGTCTCCCAGGGGCACGTCGCGTACAACGCCCGGACGTGAGCCGCGGTGATCAGATCTGACCGCCAAG
CATGATCACGTGGAGCACGAGCTGCACGCTCAGGAATCAACCAATTAC