Description :
From Genome Similarity Track
Location :
scaffold_169:5004- 24735
Transcript NameFunction/comments
Pl_108364hypothetical protein PHYSODRAFT_473852
Pl_108365eukaryotic translation initiation factor 5B
Pl_108366hypothetical protein PHYSODRAFT_468531
Pl_108367conserved hypothetical protein
Pl_108368hypothetical protein PHYSODRAFT_536754

Sequence
19731 bases(100 bases per row)
AACTTTACTTAGTTGGGAGCACTTCTGCGCCTTGTGAGCATGACCTGTCGTCCGGAATGAGACACCATCCAGACTACTGCGTCTGGTTTCTTTTCCGTTT
GGGGTCCCGCACTCCATCGCGTTCCGTAACCCATAGTTACATCCACTTGTCACACGAAACTGTCCTTTTAGCCTGCCAATCAGTACCCGTTTGGGTGCGA
TGCGGAGAATCCAGAGTCACATCGTGCCAACCGCCCCTTTAGTCTTGATCTATCAGCGCAGTAGAGTGGGTGTTTCAGTGTCACGGCGGCTCTACATTGA
GGTCTCGATTGCTTTTAACCGAGCTTCCTATTCGTTAGACGTTGTGCGCACGAGTGACAAGCTAGAAAACGTCATCATGCAGACGTTCTGTACTGTCGAG
CTGCGTGCCAGGAGATTGTACAACTCTCGTTGATCAAAAAGCGTTCGGGCTGCCCTTCGTCTTGATAAGGTTTCCTTCCGCGCATCACACTGCTCAAACG
TACTTCTTCAGCTGAGCTAATGGCGGTGCTGCTATTGCGAGGTAATGCTCAAGTTACTAGCGTTTACTGGGGACAGCAAACAGTTGATGACAGTATGCTT
GGATTGGTGTCGTGAGATTCTCACGGCGGACGACTGCACTGGGGCACACAGCGTGGGTGACGAGCAAACTCCAGGCAGGATAGCTAGAATGTTGAGTTTA
CCTTCGCGAGTAATGCATTTGGGGGGAGTTGTCACATCAGGGAACGTAAGGAGCGTCGTAGATCTCACCGGAATTGATGTCCTGTTCATGATCCCTCGTG
AACACTCGTCTTTTTCAGTTAGTCGTACATTACATAGTTTTACTCAAGTGGATTAACAAGTTTATTTTTGTTAAGTCTATTTCTTGTTCAACTTTCCCAC
TCCCTAGTCGACATAGGCAGCTCGCGAAGTACTGAGCCTTGATCAGAGAAAGTACAGAGCACTCTCAATTTCAAGCAGGTCTCACGAATCGACGCTCACC
AGACCACCGCTCGAACTCCCCTTCGGACGCATCACTGTCGACGGACTCGCTAGCACACGCTCAGCGCGGCGAAAGCTTTGGAATTTGAATGGTGGAAAAT
AATAATATTCATAATACACATAAACAGCACCCTAACTCGTATTTTGAATTGCACTTCGAAGTTCTCCAAGACGGAACCGTTCCTTGAGTTCTCGACGACC
AGGTTGTGATATCACCCCCTAACCGACTCAATCAACAATCATCTGGTCGTTTCAGTTATGTAGTATAACAGATAACTGAAAAGTCATATTAAACTATAAC
ATAATAGTATTTGTAGCCTCATTATCAATCATATAACACTAAAATTAAGGTCTTTGTGCATTGGACAAATTGTTGAAATGTATTATGTAGCATGTTATTC
CCTATTCAAGGATGCATACTTCATTACATGTATATCTTGAATATCCCTTCTCGTCTGTCAGTTTGTGAAACAAAGCGATCAGCTTGAAAATCTACAAACA
CTCTGCTTCTATAACTTGACAAGCGTTTGTGACAGTTTTACATGATACTTGTAGCAGTGTTTTGTAAATCCCTCACAGCTTTAATGCTGTAAGTAATATT
AGGGTGGTTGGTGGATACACGAGTAGTCTCAAATTCAACATGGAAATATGGAACCAGGTCGGCCATCACGATAGCCTTTGCGATGTTCGAACAGTTGAGA
AAGTAGGAGATACATTGAAGCAATATCGGTAATATTTACTCACGGTAGGTGACAGTGGTCGGAAGTACCACTTGGGAAGATAGTATGAATTGACAAGACC
CAGGTCCATGGCCTACTTCCAGACACTTGTATCTTGTACACTGAATCCACGGGTATATTGAGTTTCCTAAATGATTTTACACCCACGTTCCAACAAATCA
ACAAATTGTACAAAGAGAGCCAGGCAGCTGACTTAATAACCCACAAACTTCCCCTTGCGTGATCTAGCGTTGGCCTTTACTAGACATGTAGCAATATTTA
TATGTAGATATAATAGCTAACATCGCCTGGTGAGTTTCATCCATAAGTATCATAATGATTATCTTCATATTACCTTGTAGGGAAGCATAATTGCGAGAAT
GTTTATGTCGAATTTGCTCTACCGCAGCGAACATTAAGTTGTAGTGTTTTACCGAGGATGCCAACTGATTTGTAAACTTGCATGATGAGGCATTTTCATG
TTACATTCTTTGAGAAGTGCGGTTGGCAAGTTTTTAAATAATACGGAGTTGCAATAAAATGGACCATGTAAGGCAAGCTCTTGCCACCCCCGGTAGGAAG
AATAACTATTCGATACCATGCAGGAGCAGTTAAAAAAGTAGCAAATGCCAATCCTTGCTCCTAAGATGAAAAATTTGCATTGCCAATTCTAGTCGATTTC
TCAACGACAAGTTTGGCTTTGGAAACTGTAGCAGCTAAAGCTTCATTGTGCGCGAACTAGCCCTTGACTGCGTTGGTTTCACATTATATCCTTGCAAATA
CAATAGAATTTTGGTTCTGTAATAAACTACGATACTGTGTCAGGGAACGGTTACAACATGGTGTCAGTGTGATTCGTTGCCACATTTCCTCCTTAGTTGT
TATCCCGTCTAAGAAAGTATTGTCATTCCTGCGACTCACTCCAAACTTTTCTAATTGTTGTGTTGATATACCCGATGGGTCATTCGAGCTTCGATCATAC
AGAGTAGTAGCTGTTTCGTGACTGTGTCCTGTCTGTTCATCTAATAGGACTATACATATCAAATCAGGACCTCCACAAATGCTGTAGCAACGTGCCTGTA
TGTAGAGACGTCAAGTCATATATCACTAAACATTTAGCAATACCTGTCCTAATTTGATCTGCTGCTGTGGATTTCCCGTTTTTCATTATTACAGAATTGA
GGTAAACCTCACCAGGACTGTCATTGTCGTACAACTTGCAACTATAAGCCTGGATTGGTCTCACCAAAAAGAATTATAGAAAAAGGTCGGCGTGTACTAC
TAGCGGAGAAACCCGATCAACAGTTTGAATCTTCAGGTTACGTTGATACATTTTGGTAGCACGAGAGAACTGTGATTCGATTTCGAATTGCAAAATCAAA
TGAATAGCTAGGCTATAATCTCGTATCCTTGAAGCCCATTCCGTGTACCTTCTAGGCAAACAAAAATTAGGAGTATTGTAAAAAGAAATAAATCCATGAT
CGTTTCGCACTCACGTAACCATTCGTGCAGTTTTCTTTCATCCAAGCGGTTTTGATTTTTCATCCACAGCGATATGAAATAAGAAAAAAATCGATCGAGG
AAATAGTCATCTGGTTCCTCGGTCGGGTTATAACCACTGTCTTGAATTCTCGAATTTATGAGGCCTGTAAACTCACAAGCTCTGATTTTGTTTCGTACCG
AGGACGTATCAAACTTGAAGAAGTCTCCAATGAAGTTTTTCTCGAAATTGCCTTATTGAATACATTACTAGGCTTTGTAGTCCCATTTTTGTGACAACAA
CTGTTTTAGTGAGATATGTCGCTTGTTGGCATTTTCACCATACCTATTTTGGTCTTGGACCATCAGCCGACACTGGTTGTGTCTGTGCAGCTTCATTGTC
GCGAAAAGAGTTTTGAAAGACGTGGGGTGTCTATTCTCAATGTAATCCGAAAGCTCATCTCCGTTAACACATTGAGGAGTATGCTGAGGTTCTAGCACTG
AAACAAACTTACCCTATACAGAAATGACACAAAAATACTAGTGACGTTGTTAACTTCCAATACTTACAACTGAATCGAATTTTCGCCGGTTATACTGGCA
GCAACCACATATCTATAGACTGGGTATAGCTGAAAAAGCATAATCTTAATTTGGCTGAGCCTCTAGCAATTGGGACTTAGTCACAAAAAGCCCTTGAAGA
ATACGCAGCATTTAAACGGTAACTTGAGGAGATGGTGGATCCGAGTTACCAGCACAACTGAGGTCGTACAAGTATAAAATGATCTTGTCTACGTTCGGGG
TTGTCAGTAAATTTCAGACACTTATATCGCCTTTTTTCAGATCATAATTGTATTTTACTATATGAAGCAGCTTATCCGTATGAAACCGATAATTTCCTTG
TGTGTAATCCGTTGCACTCAAAAATTTGTGATACTCACGCAGGATTTAATTCCTAGTTTAATATTAAGTCGAATCAAGTAAGATATTGCTCGTACTGTTA
TGAAAATACGATGACACTACGGAGCGGGCACTCTTTTACACACTTACTACTACAACTCCAATAACACGATGTAACTTACAAATTATCATGTTTGTGGCAC
AGCTACATCGAGAATAGCTTGCAATCGTGTGAGACTTTCGTTTTCAGGAAGAACTATCTGATTCGTCATTCAGGGCAACACCATTGGAGTGTTGGTATCT
TGATATCACCCAAAAACAACTTCTCGTAAGTCCTCAAAACAAATTCCGCAGAGGCAGTGCGCCGAATTTAGGTGGCGCTGAATGGTGCAGTCACAACAAC
ACATGAAGTTACATTCACTACACATATTTCCATTGTGATGTTTGGATAAGCCATCAACAGGTGACACTGTGTTAGGAATTCACTTGGATCTACACGAATA
TCAATCTCAGAAAGTAAGATGGTAGATTGCATAGATGTTGTAATGTCTTCAACTGACGGAAGCGACTGAGACGCAACTTTACGAATGCGACTAAGATGAG
TTATAATTTGTTTCTTGTCGGGACAGATGCAATACCAGCACCGTTGACAAATCAGAATCCCAACCTTCTGGTTTATAGTGAGCTTGTACATTTCTAGACA
GGAGTTCACTCTAAGATATTCAGTATTTCTCCAAAGTTCAAGATGACTCGACCATCCTTGCTGTTCATACACGGCTTAGCAGTATGACATCGATAAGCCT
TTTATCATTTATACTCACGTTCGCAATTTGGATACTTAAAGCTGTTTGTGCCATTATCACGTTGTATCTTTACCGTCTCACCATTTGGAAACTTCACTGT
TGTCGATTTCTGATGATAGCTTTGAATATGCTGATCGTGTTTTATAGTGGTGTTAGTCACAGTTAAGTTCACTTGTAACTCTGTTCTGGATTCCGGGGTT
TGCCATGCACAAAAACGTGTCCTCGGTTAATTCAGTTTTCATGTCAACCTACCGGAAAAATCCTAATGTGTATGCAATTAAACCGATGAGACGCTGGTCC
AATACTGAATATCAGTGGCGACGTGATTGCTTAGATCAGATATTTCTGAACCCTCATGCTGATCTCGACCTCGATGAGGGTAATCCCAAAGTTCCTTTCC
AATGGTTATATTCCCTTGGTGTGGTGATAGCAATTCGGTGGATAGCACAAAATTACATCTTTTCAGCAAGCGTGCAGTCAGGAACAACAAGTGTAGCTTC
GATTGATATGACAACAAGTTATACATACGTTTGATAGTGGTTCGCAAAATTAGTTTCCACAAGAGAAATATAGAGTGGAGATTTTTACGAGACTGGCATA
AAGCTACTATGGATGTTCATTCACTGCTCTGTTTAGCGATCCGTTTAACTGTATCGTGTGATGAAATTTTGAACCGTGAATTTGGTAGTGGCATCGATTG
GAATGTAGCAAACAACCCAGAACGATACGAAGACCGACTAAAAAGACGTAAAATGCGCCCGTTCACACAAGTTTAGCCGTTTCTGTGACATGTTAGGAAA
GGTATTCAGCATAATCATAAAGTAATCAAACAAGTACACAAAAATTAAGTCTACAGTTTGAACGTGCAAATCGTGGCAAATCACTGTAGATAACATGTCT
CGTGAGACAGTATCATGATATTCTTAAAGGATGAAAGATGCGACTTTTTCGAAGCGAATTAGATTTTTATAGTGTAGTTTTGTCAAGTGGGCCGCGAAAG
AGTTAAACATGAGTCAGCCGCAGTCGCAAGCTAAAGCAGAAAGAGTTAAAACTGTCAAGATATCCTAAGGGTTCAGATACACCAAGTCATAGCACTCGGC
GAAAAATGGTACCTAGTAAACATTAGGCTGCAACACTGTGCTTAAGATCACGCTGATAGCAGAATGGATAGCAAAAAGAGTTCACACGAGCAGACGCGAT
AGCATTACCTATGGTTCTCTGACCAACGAGACCGATTTAATGAAACGCATGGCCTGTTGGATATTACAAAGTTAGCCATAGAATTTCGGGTGGCTTGGTT
GTAGATAGATGGTAATGCGGTTGCAATGAAGGGAAATTTAATGTGTGTCACAGTTTATCGATAGTACTTTCCGATGTGTACCACGAGGAGTCTACTAGTG
TTTGATAATGACGGATGATGACCCGGTCCGCAACATATTCACGCAAGTTTATTTGTCCTCTGAACGGTAATCGTCGAAATGATATACATAATATATTGCG
CCGAATTAACCGAGACATGGGTAAGACAACGACTCCTGCAGAAACTACGCGTAACATCAAGTTTAGTTTGATTTCGTCGGTGCATTAACAGCTTTCGAAT
GCAGAATTGGTTACGTGCTTCTTTTATTTTAATTAAGCATTACGGCGCCGCATAAACATTAACGCATCATAAAACCTGATATTGGAATTGCACTGGACCT
TGATACTCTTACTGTTATTAAACGAGGTCTATTCCCAAAGGAATCACTACAGTTAAAATACAGATTAGACAGAAATGTCTCGATAAAGGTTATTTAATAT
TTACATTATTCTATAAATATATATTCCACCACTACCTTTTTTATTACTACTACTGCTATGTATCCCTTCCTCCCCTCTTATCTTCATTTGCCTTTTTCCT
AATTTTCAATCATTGTAATATTTTCACTTCCATTTGTCTTCTAAACAACGTTTTAGTGTCCTTCTGATCCACCCTGTCATTTTTTCAAGCATTACAGCTA
TTTATTTTCTACCACAACCTTTCTTTTCAACTATCATTTCCACCTTTATTTCCTTTCTTTAACTAACACATCTTTTTTTCTTTTCTCGTAATCGCTCATC
TGTTTTTATATTTCACGTACTTCTTCAAACTGTTTACCTAACCAATCCAACTATCTAACCATACTTTCTACAGTATCTCCAGTTTTTCATTTCTACCTTA
TTCACCAACTAACGTTTTGAATCAAAACATGAAATTGAGCTTTGTGTAGTGGGTCCCCACATCGACCACGCTTTATAACATGCGCACAGTCGTGCGAACT
TCCTCAAACTCAAAACTCACCAAAACCTTCACAAACTAAACTTTTAACCCAGACCACTTTCCAGGGAATCGAGCTGAGACCCTGATGAGCCGGTTCGTTA
AACAACGCGATCTCTGTCCAGTATTCATAGTCATCTGTTGTAGTAATGAATTTATTTTGTACTATACTATATGAATGCATGAAACAATAAATTAATTTCC
ACGCAAAACAGTAGTTATTGTTCGAATACAACATCAGTGTGAGGCACTGACCACCGCATCGTATTCGATTTTCAGGTTTGGCCACGTGTTACATCAAAAG
ATTGCCACAACATTCGTGTAGATATCGCATAGAGAGCTAGTCAATGTGAAAAGATAAACTATGTATAAACTGCGTTAAACTGACAATAGGTCGCGTTGAG
GCCCTCGACGGGGGCGCCTTGAGAGATGCAAGTTCGCTACGTGGGAAGTGTGTCTGATTGATATCTGACCAGTGGGACGTGAGCGGTTCACTCACACGCT
CACGTAGTGATTCGCTTCCTAAAAACACAAGACCCAGACAATCAGTGGTGACGAAATTCCCGTGCACAAGCTTAACGAGACCAGTGGCCAAGACAACCTC
GCTGTTAATATTGACGCTACTGGAAACACTTCTGACTCCTCTACGAACTCGATCGTCCGCTCTCATCGTCGCATGAAGGATCCGGTGTGTTTAACTATAT
TGAATGCCTTAGCAACGGATTATTTCACTGTGTGCAATTGTGAGAGTAGCGGATTCGAGAAAAAAATTGGCATTCCTACTGTACCAATGCACCTCATTGG
AAGTCATAGTGATAGATACCGAATGTCAAGGCTTCGGCCATGGCCCCAAGCCGCACAAACGTCTGACGAAAAAAACGTTATTTGGATGGTTGTGAACTCT
CAGTCGTTTGGTGATGTTGATCAAGAAGTGTTTGTAGCTTTCTGTCATTTATTGCGCACGGACTACAATGTGCCCTACCAAGAAATAATTCCCAAAGAAT
AATGATGCAGTGAAGGGCAGAGAAATCTGTCGCCCGAGTTGAACTTCGTCGCGAAGTTGCCGGTTGGCGTACCGGCTTCACCTGATATGTGGACGTCTCC
GACAAGATGCTGTTATATAGTAGCGACAATGCACTTTATTGTCCGCGATTGAGCGATTCGCTCAGTGATTATAGCGTTCACACGAGTTATGTATATGGAA
CCTGAGTTTCTCACCTCTATTTGGACTGATACATCTGCTAATGCAACCAGCAATGCAAGTATGACATCATATTTGAACAATCGGCTGCAGTGTCTTTCCC
AGTCTTTCCTTGAGTTGGCTTCAAGATCTTCTCACTCAGATCGAAAAGCGGTGCAATTGTGTTGCATAGCGCACGTTCTTCGGCTAGCTGTTAAGAAGGG
TCTTTACCAGTTGACCCAACAATTGGGCACTTTCGTAATCTCGTGAAAAATGTCTGCTTTCCATCTATAACTGCCTGAGGTGTCAGATTTGTTGAATCTA
GTAGAACTGTCCATGAAGGGCTTTCTGGCTGAGTTAGAGAGCTGAACGACGCGACGGTTCCGGCGCAAACGCCGATACCTCGTAAAGATATTCTGTTGAA
CAGCATGGCAGGCTGTACGTTGTACAGTGCCCTGGATCTGGTAGATGGATATTACCAGATCCTGATGCGTGAGAGCGACATCCCGCTCACGGCGGTAAGC
ACACCGAGCGGAACGCTCTGGTAGTGGCTAGTCATGCCACAAGGACTCTCGAATGCCCCGGCGACGTTCAATCGTCTGGTCACGCAATTATTCAGACCAT
TGCGTGACTTCGCGCAGACGTACTTCGACGGCATATTCGCCTATAACCGTGCCTAAGATGGCCAGACGGCTATCGGGGTGCCTCAGCCGAGTGCTTGACA
TCATTAGAACAAAACAACTCTTGGCCAACATCGATAAATGCGTCATTGCGGTAGATCCTCGGCTGCTTTGTCAACAGGATCGGTGTACGTTCTGACTCGG
AGAACGTTAAGGCCATAGCTGTGTGACCGACTCTAAGATCTTAGAAAGACCTTTGAAAGTGACTCGGCTTAACCATCTACTTCCATGAGTACAGCTCAGG
CAACGCTGCCCTTGCTCGACCTTTGTCGGATCCCTTAAATACAGTTACCGATTTGGTCTGGGATCAAAACAAAAGGTTCCTTTCGATAGTACCAAAGTGA
GCCTACAGTAAGCGCCAGTCCTGGCTTCGCCGGACGAGACGAAATCATTCAGCGTCGTTTGTGATGCTCCCAACTATACAATCGTCCGTGCGCTGCTGAA
GACTGATGAAGAGGGAGAACTCGTTATCTCTGAGATGTGCTCCGTCCGCGTGTCTTCTACGATGACTTAAATCCTTCCCAGTAGGGCGCTCCGCGACCCC
CGTTCCCCTGGACCTTATGTTGCGGTGTTTGTCAGTAACCCATCGAGCCCTTGGATTTGGAATAGTACCTTCTTTGCCCACCCGCAGGACAGGCAAGTTG
CATGTGCCAAAGGTTACCGCATCCGTAACACCGGTTGGAGATCTGTTCGGCCTCACCCAGTTCCATAGGTACCTGGTTTGTGGGAGCCCCTTGTGCTGTA
CTTGTTGGTGCGCTGTGGCCTCGGCACAAAGAAGCAGGGGTGCGAGACTGTAGATGAATGTACCTCTCTTGGAGGGCGATTTGGATCCCATCTTCCATAG
TACTTACCTGCACACGGAACAACTGCGTGCGGGTCGGGCTTACTCTCAAGACTTCCGTGAACACCATAACCTTGATGTGTTCAGGTAGAGAGTTATCTAC
TAGAGATAAGGCAAACACCTGCATCACCAGGATGTACTCGTGCAGTTCATGCTTCTCTTGCTTACAGGCGAGGAAATGTAAACGCTGGCGACGCTAGTAG
TTCGCCAACTGGAAGACGGCAGCTATGTCTAGGTTTCAAAGCAGCCCAGCGGCATCGCTGTAAGCGTGTGCGCCTACGTCTTAGCGCAACCGATGAGGCT
AGATATCGTGAAAGCAACACGCAGTTGCTTGGGTAAGATGAGAGCCGCGTCCATCGCGAGCTATTACTCTAATCCAGAAGTGGAGGTTCTCTCCCTCCTT
CCCTTCGTAGGGACATACTTTATGCCGTAATGGCTTAGGTTATGCTGGCCGCTATTCGGTCGTGAAGGCCAGCAACCCCTGCACATGAGCGATGAAGCCT
CCCTCGTAGGTGTCGAGCGCCTCTATGCGTCCAGTCTGCTCGACCGGTGTGGCTACCTCCAAGGTACGGAGGACCTCGTCTTCATAGATGCCCGTTACCT
TTCGGTCCGACTCAAACTGAGCATCGGTCAAATGAAGGAACTCTCCTCTGTCCATCATGGCCGCTATCTTGAGAATTCAGGCAGTCAATCTACCCGCGTA
GGTGTGCGCTGACTACAAGTGCTACCAAGTGTGACTGGGTCACACGAGTACCTTGCTTCGAGGAAGCGTGCTAAGCCGTTCACAAGTCTCTGGTCTTAAG
GGACTTAATAGCTTGAATGGCCTGCAATAATTAACAATAGTTTGTTTCATATAAAACCTGGTCGCATCTGATTGGGTGGATCTCAGCCACGTGGTGTGAC
GTACACCACTGATCCAAGAACGGATTTAGTACTCTGGGCAAGCCCAGCCTATTCACCAGCAGATGGACACTGCGAAGATATTGGAGCAGGTATTAGGAAT
GGTTAACAGGGTGGATACCGACAAAGATCACTTATTAGACATTTAGTCAAGAGCCAAAGCCAAAGCTACAAACAAAGCATTACATTCACACGCTGGAGGT
GTATTACTATTCTAGATACGCGTCATGGTCGTTATTTACATGTACACTAGCTACACTAGTGTGATCTCCACGGTCCGCGCTCTTGCTCAAAGTGCGATCG
GGCGACTGGAGCGAAAAATGTGTCGCTATCCCACGAGTATGGAAACGACGGGAAGGGCTCGCCACTCCCGTGACTTGAGGCAGCGTACAGACTGCCTGTT
GCTCCGAGGTCCAGGCACTCGTTTAGCATTCGAAGCTCAAGCATTTTCTCGATGGATCGACTGTCTTGACGCTCTGACAAGGGGTAAACAGGCAGAATGA
TGTCATGCAGCTCGTCCACAGAGAAATTGAAGGTCTGTTCCGACGAAGAGCTAGTAGGAGTCCCATTGTTGCCCTCGCTGGCCTTTAAGAACCCCACCGG
ATCTGTCACCCAGCGAGGTGCACACTTAGTTGGAATGGAGTTCGCCGTGATGGACAGACTGTCAGTCTCCGTGGATTGAGACGCACGATTATAGATGTCG
CTTTCGCGTTTGATAGTCTTTGAAGCAGTGGAGGAAACCCCAACGTCAGCGGATCGCATCAGCTCTGTGAATGTTCGCTTGCGCTTGGCAGTTGAGGAGG
CGTCGACAACCGATCGCACACCGTTGGTAGAAGGACGTCGACTGATGAACTCGGCCAGTTGCTGCGGGTGGCAGCGCACGAGGTGGTGGTGGCTAAACGT
GCAGACGCTGGACTGCGTCTTGGTCCACTTACGGAAGCCAAAGTTGTTGAGCTGGCGCTGGAAGCTCGCGAACTTGCCGTGCTTGAAGTATTTGGGTAGC
ACTACGATCTCGAGTCGCTTGGTGTCGAAGATCTGGAAGTAGGTGCCGTCCTTCGACCACGTCAGGATTGACTGGTCCTCGTAGTGGAGGATGTCGTAGA
GGCTGCGCAGGAACTTGGGCACGCGCATCGCTCGGAGAGAGCTCGACTTGGAGGTGGCAGTGCCTACGCTAGTGCGCTCGGGGTGGCTGAGCTGCTGCAT
GGGAGGCATCCGCATTCTGTGCATCATCGCGCCGATCTGAAGAGAGGACGGTGGACGAAACTGCGCGGAGGCGATCCAATTGCGAAATGAGGCAGGAGCG
GGCGCCCCAATGCCGTCGTTTACCTGCTTTTCAGTGGACCCCATTGGGTGCACGTGCCACCACCAGAAGCGCCGACGTGGCCACGACGAGCATACACACA
AAAGCGGAGTCGAGGTTCCATGTTGCACGTTGCTTCGCGTGGGGCCAGCGCTCCCTGCTGAACCGAGCAGTTCTCCCCGTTCAGCAGGGTCCTTGCTCGC
TTCGTCCGCCGTCGTCGTCCCGGAAGGTTCGCGCCTGAGCGCTGACGCACGTCTCGCTTTCGGCTGTCCCTCCTGGGCACTTCGTCTAGTACTGACCAGC
AAATCCAACAGCTGGACAACTTTAATGCTGGATCGCAACATCGCTTTGTGCCGCCCGCAATTGCTGCTTGGACAGGGCTCGCTCTGTCATGACTCGAGAG
CAACTGCCTGGCCTCGAGCTCGTCATGGATATTATCATTTGGTAAGGACCACCGCTTCAACTCACGTGCAGAAGAGGAGGGCGCCTTCCAGCTTGAGCGA
CTAGCAGTGTGGTATAGAGACTTTGCAACCGCTGATCTAGTGTGCTACGACGCACAATGCAGCGATGGTGTTGCTCATCCTCGCTCCCTTCAGCTCGTCG
ACCGACTCGGGTTCCAAGCGCGAAGCTGATACCTTGTTTCCCACGACTGGGAGATACTACTTTTGAAGGACTTCGCTACACTCACCACGATCGAGGCGGA
CTTAAGCCAAGTGCGGGTATTGATCCAATTCAACGCTGCTCATGGCAAAGAATGCGTCTGCGTAGATCACAAGGATGCAGCGCCGTGACGGAGCACCCAC
GTAGTACGTGCATTGGTACCTGTCCAATATCTGCTCCACCCGTTGCTGCGCTTCTCCCGGTGCGGTAATGCGGAGTTGTTTGACGTGCATCAACTCCAAC
CCACACAACTTACAGCGGAGTTCAGCGATTTCGATCGCGATGTCACCATCACGCTGGACGCGACTGAACTCCATCCGAATTCCGATGTTGCTCTTGCTGT
GGACGAAACACGGTGTGCGAAAATCATATATGCTAGAACATAACTGTCAACGCTGGCAAGAAACCTACATGTACTCTGATCTCAACAGGAGTCTCCTCTT
GACGCCCTCTGGTCAGGACGCGAAAGATCCCTTCTCTTCCCTCGCGTAACACACACGCTCTAAATGATATCGAACACCTTCTTGAGCTTGATGACTAGCT
GCCAGTCCTCCTTCTGCAAGTCTTCCCGGAAATTCTCTTTCAGGGCATCGATACTCTGGCGGGTCAGGCGTGACACCAGCTTGTTCTTGTGGTCAAAGTG
GCGGCCGTACATGACGCTCCCCTCGTTATCTATCCGTACGGCTACGGACGCCCCCTTTTTGGCACGGTCCACCTCCTTGTGTTCGCGCTCGATGGAGCCC
ACTTTGCCGACCAAGAAACCACCGGCAGACGGCACCACGAGTGGAGTGCCGATCTTGAGTATACCCTCTTCAACATCGACGCCGAGAATAATCGGATCCT
TCTTGTTGAAGACGCAGTTCGGCAGGATCTTTAACACACACGGAAACACGGCCACCTCAGCGAACTCCTCGCGGCGGGCCATACGGAAGTTGTCCATGTA
TGCCGTGAACTGGTCAAACAGGTGATAAATGATATCGGCTGTGAAAATGCGCACACCAAGTTCTGTAGCCAGCTCAGTTGCGTCGCTGTGGACCTTAACG
TCGAACGCCAGAATGGTGGCGAACTCGGGCTGGTGCTCTAGCTGCACAGAGGCGCGCATGACGTCCTTCTTGTGGACGGGTCCAATGTTCACACACGACA
CTGGGATGGGCGGGTCACATGTGCGCAAGAATTCCAGAAGCGCCTCCAGGGCACCTAGAGTCGAAGCCTGAACCATCACACCGCGGCGGGTAGCCTTCAC
CGAGTCCAGGATACCCGTCAGGTCGGACATGACAGAGTCCTTTAGCTCCTCTACATCATCGTCGGGGCCAACAACGTAAATCTGGGTACCAGCAACAGCC
TTCTCGAGCCCCTGCGCGCAAATCTTCACACCCATGGCGGCCTTCATCTTCTGGTGGTGGAGGTACTCGCCCTTGACACGGATTTCTTTCATGGGGTGTG
GGGTCAACAACGATCGGATAGTTGTCACAACAGGTCCGTCCAACGTACACACGACAATCGTCGCGCCTTCTTCCAGTGAACCATTCACTAGAATTGTATC
AATCGTCGTACCAAGCCCCTCAATGACCTTCACTTCTAGTACGGTACACTGCAAGATGTCCACGAACGCCAGTGACTTGGCCATACGCTCCTGCGTCAAT
CGCGTCAGCATCATCAATAGATCGCAAACACCCTCACCTGAGACAGCACTGGTAGGGATCAGCGAGACTGTATGCGCCAAATCCTTATTGCGCCAGTAAA
CCTCGGCGTTCAGCTTCTGCTCGGCAAACTCCACAATAATCGCCTTCATGCGGTCCTCAAACTCGCGAATGACATGCTCGTTCTGGTGCTTGAGTGCCTC
CTGGACGGGCATATCGGGCATGGTCTTCCAACCGTAACAACGATCGATTTTGTTCAGCGCCACCACAAACGGGGCCTTCTTTTGGCGCAATAGGCGGAGA
GACTCCAGAGTCTGTGGCTCCAGACCGTGCATGATATCAACCACCAAGATGGCGATATCACACAGCGACGAACCACGATTACGCAAGTTTGTGAACGACT
CGTGTCCAGGTGTATCAATCACAAGCAAACCGGGTAGGCGGTACTCCAACTTCATCGTCTCAGCAAGGCGCGCCGTCTTCTGTTTAATAGCCTCCACAGG
AAAGAAGGTCGCACCAATCTGCTGCGTAATACCACCGGCCTCGGCGTCCTGCACCTTGGTTTTGCGGATGTTATCAAGTAGCTTAGTCTTACCAGTATCG
ACGTGGCCCATGATACAACAAATAGGCGAACGAAGGTTATCGAGGGACACATTGGCACGGGCGGCAGCCTCACGCTCGCGACGACGTTCCGCTGCCTCCT
TCTTCTTGCGTTCCGCCTCAAGCTTAGCTTTAGAACGCTGGCGCTCCTCTTCAGCCTCTAGTCGCATTTGCTCGGCCTGCTCTTCCTGGCGCTTCTTCAG
TGCAATACCCTGCTGTCGCAGACGCTCTTGCTCTTTCTTCTGTTCCAACACCAGCAGATCTTCGTCTCCTTCACTATCGCTCTCAACAGCAGCGGCAGCC
TCTTCCTTGACCTCTTGCAATTTATCTTCCAGCGAGGCCACGACATCACTAGTTTCCCAGTCCTCGTCATCCCACGCATCAGGGGCTTCGGTTTCCTCCT
CCTGCGTCTGAGCAGCATCCTCCGCGGCCTCCCAGTCGTCCACTTCCTCCTCTTCTTCTTTCACCACGGGTTCAACTTTCTTAAGCTCTTCCTTCTTCGG
CTCTTCCTTCTTGCTGTTTTTCTTGTTCTTCTTCTTGTTGTCCGAGTACACGATTTTCTTCTTCTCACCAGAAACGTCAGGCACGAGACCCGCCTGGTGC
ATGGCTTCGAGGGCAGCCTGTGCCTTGGCTGCCTTCTGCTTCTGGGCCTTAGTCATGTACGTGCCCTCCTTCTTCTGACGCTCGATCTTGGCAGCACGTG
CTTCCTTCTTCTTGCGACGGATCTCCTCCTCACGTTCAATCTCCGCCAGACGCTTAGCCTCTTCGTCCTGGGCAATGCGTTCCTGCTCCAGTCGTTCCTG
CTCAAGACGTTCCTGCTCAGCCTTCATGGCTGCCTGACGCTCCATCAGCGCCTTGGCTGCGGCCGACGTGGGTTTCTTGTCATCATCCTTCTTGGCATCC
GCAGAGGGTTTCTTCTTGCCCTTCTTCTTCTTCTTTTTGTCATCCTTCTTCTCACTTCCGGCAGCGGGGGCCACACCCAGAGACGCCAGGTACGCAGCGG
CAGCGGCGTCCACGTTCGACTCCTTCTCTTGCTGCTGCTCTTCCTTCTTGTCCTCCTGTTCCTGCTGCGGCTTGGCGACCTCCGTGGGCGCAAACTCGTT
CAGCAGATCATCGAGATCATCCGAGGCGGCAGCCGTATTTGCGCCCTTCTTGGCGTTCTTCTTCCCTTTTTTCGGCGCCATCTTGTCTTGCTTCCGCTCT
TCTGTAATGAGGTCGAACAAGCTAGCTCGGTAATCAATGGCTCACACGATTCTACCCGATCATTACTGAGAGCAAGATGTGAGACCCTATTTTGTCGACT
TTTAGCATAAATTTTGACAAAATAGGGTAAATGAGATGGTTGAAGTCTATCAATATCTGCTACCACAAGAAGGGAAGAATGGCCTTCCGGCTTGCTGAAT
ACTCCTCGCGAAACTTGTCTTGATACCAGCGGTGGTTGCTAAGTGCCCGAGGCACGAGGTTCGTCGCGGTGTACACTGCGAAAGACAGACCCGCTGGCGA
TTGAGACAGCAATGCCCAGCCTGTCCACTCCAGCAATTCACAAAAGTAGTTGGGTGAAGACACGTACTCGAATAGACCGCCGTGGGGGATCTTATAGCCA
CTCTCCCCGGGCTTGCGAAGGTTGATCAGCACTTGATCCGAGTAGATGTTCATCGACAGACCGAACACAAAGAGAGCGACCCCAACGTAAAACGACGGGC
GAGTGAACATATCGTCCTCGCTGTAGTCACCAAATTGACTCAAGTACCGAGCGTTGATGTACGCATTGATTCCGTTGTAGAAGTCGCCGGAGAGCATCAC
GGTCAGTGGCATTCGTTTGTCCTTGCTTGTACGAATCAGGAACGGATAAACGTAGGAGCGGTAGACGTAGTGGCATACCCACAAAGTTGCTGCGGCGAGG
GGGGTCGTGTCAAAGCGGTGATCTCCCCGTGAATACACGACTGCAAACCAAATAGCCGAAGGACTCTCCATCAGCACCCAACCGAGCCGTGTGTTCACTG
TTGGACCCCATCCGGGCCGAACGTAGCGGCCGTAAGGTGCTGTAATGAGCGTCGTCACGACGTACGTCACCACACCCAGCGCGAAGACGCCGTTGACCAG
CCAGCCATGCAGCTCTTCCTCCGTTACAATGTTCAGCGCGTTCATCGTCTATAGACTGGAGATCTGCTCTAGTGGCCAATCAGGCGATGTGACCACCGAA
TATCAACCACCTGTGTGTTGTGGACCGAACTAACAGCAACTACAGTCAGTTCGTGAACAATGGTTGTCTCGAACGACCGATGATAAGCCAACGATATAGT
AATTATCCAAAATCCCTAGCAACACCGAGGTGCCTTGTTGGAAGATGGAAAGCAAGCGGATACCTATCGACTCCAGGCTGGGTTACATCTCATAGACCCT
CTTGATACGTCTCTATCTCTAGGCTCGACATCTGAGAAGTCTGTCTTGAGATGACGATCTTGGTTGTCCAAGCAAGAACTCAGTACGTAAACAGGAACAC
ACATATTACCATCTTTGTTCGCGACATACTGCGTTGGCGATATAGCGCACACACTTGGCCTGGGATCCATTTTTCAGGCTCATGGAGATGCTTTATTCAA
ATAGGGCACGTGTCACGAAGAAGTCATTCATCCACCCATTCTTGCACGTGTCGACGGTACTTCAATCGCTCTGCCAAAAGGTGGTGAAAACCAACACCCG
CTGGTCACGTGCACCCGTTAAAATGCAAAACAACTATGCATAGTCACCAGTGTAGAATTCCTTGCACTCGATTCTTCCGGGAGACGAGAATCACACATCC
AGTCAGCGGGATGTGTCACACCTTCACCTTCTTTATGCGTCTTTCATGTACGTGTCCATCTCATTGTCCAGTTCCTCGGCAGTCTTGGACGGAGTGTGTT
CTTTGCTACGGCCACTGTAATACAGCAAACACAATACTAAGAATGACACCCTGACAAAGCGCAACTATTTGATTCGTACCCCTGGCTGCCTCTGTCGTTG
CCACGTCCACGGCGTCGGTTGCGGCGGCCTTTTGCCTGTTCATTGTCGTTATTTCCTCTGTTGGCAATAGAAGCAGTTGTCAGACTTCAGTTCTCCAAAT
AAGTCAAAGGTATCTTACCCGAAAGAAACCTTGAACTTTACGTCCTTGTCATCACGCTCAAGTGCCGTGCCGAAAAGTCCATTACGAACGTTCTTGTCAG
AGTCCAGTGCAATTTGCATCGGTTGGCCATCCAGGGTACGTCCTACAGTATAATTACAATCGCACGACCCACAGACGCGTTAGTGTTACGGCAAGACAGG
ACCTAAAGTAGATCAAAGGAGGTCTACCGTCGTATTGCTTGATGGCCTTGTCTGCGTCCGAACGGCGGGTAAACCACACACGGGCAATGCCCTTGGACCG
CCCTGAGCGGTCATACACGATCTCAGCTTTAGAAACTTCGCCTACTGTGCCGAAAAGCTCGCGGACTTCCTCCTCCAGAATGTCGAACTTGAGGTTCTTC
ACCAGGATCTTCGTGCCGAGGCTGGCTGCATCTTTGCCGCCGAGACGAGACAGGATGGAAGAACCGCCTAGAATTAGGACAGCCATTAACCATGGAGTTA
GCACAGCGTTCATCCTCACAGTACTAGAAATAATAGTGGTGTTCGATCGTACCCTTTTTGCCGCCTTTGCCGGCCTTCTTCACAACCACCGAGCGTTTCT
TGCTACCGCGGTTATTTCCATTGTCAGGGGCGTCGTCCAGGTCGATGTCCATGTCATCGTCGTTGCTGCCGCGCTTTTGGAAGCAAGGGAGAAGCATCAG
GATACATGTGAATTTCCGCACCAACGTAATGTCCCTAGAAGGCAAGGAGGCCCCATGCTCCCCTCAGAGCACGAGCTCTTTCTTTCTGTCCATCGCAGAG
GCAGGGAGCGACGGGCGGGAAGTTGCCTTCCATGGTGTAGGAGACAGAGAGAAGAAAAATAGACTGCGTGGCGGCCCTTCAGCACTTACGGATCGAGAGT
AGGGCTGGTTGCGGCCGCGGTTGCGTCGGCGTCCGCTGCGAATGGGGCCAGCTGCGTTTTTGTCTTTGTCGGCCTTGGCCGGACGCGATGCCGGATTGGA
AGCCTTGGTCTTCTTGCGGGCGATCAAGTCGTCCAGACTCATATCGAGGGACGCGAGGATAGACGACATCTTGCTGATATCTGGTGGGAGTGGCGATAGA
CTGCACAAAGCAACGGGGAAGCGGGTAGTCAGCAGCGCGGAGGGGGCATAAAAACCTGAAGTCGTACCTGGGAGTTTCTTCTACGAGTGAGCCACGAATC
GACTTTTTGGAGGGGGTGATGTTGCGTGAAGGTCGCGCGATTTTCAGACAACATTTGATACTGAATGCCCCTTTGTGAAACGGAGATCTAAAGCAGTCGA
AAAACACTGTAGAACGATGATGAAGATGCTTCTAGGCGCCGCGCTGTGCGGTATTGCGGCTGCAACATCGGCCACGTCGGCCGCCACCTTGTTCCCCCAC
GTTCCTCTCATCATGTGGTCTCAGCGCCCGTACGTTCTGCCTTCGTTCTGTCTATTTGAACTATGACATTTTGCCTGATTTTGCCTGTGATTCTCGCGTA
TAGCACCTTGGCTGGATCTAACGTCTACCTGAGCACCGAGATGGATGAGGTAGCTGTGGCATTGACCGTGAAGAATATGCTAGACCGCGATGCGAATGCT
GATAAAGAGGTATGTTCGGTTGGTTTCATAC