Description :
From Genome Similarity Track
Location :
scaffold_919:5004- 6443
Transcript NameFunction/comments
Pl_101865adenylate cyclase, putative

Sequence
1439 bases(100 bases per row)
AGAGCCGATTCACTCATGACGATCTGGCCTCCTTGCCCCATCTCACTCATCTCGCGCGCCATCATTTCGCTGAGCCCTAGATAGGTCATTTTGCCTGTCG
TCGGGTGTCTTGAGCACACCAACCGATCGTCCCCGTCGTGAATGGCCATTCGCACTCGAAGTCCGTTGAATAATAATCTTGTCCAAATATCGTACACTCG
CGCTGCGTTGTCGTATTTGAGCAACGCAGTCGGCCACGGAGCCTTCAACAACTTCTCTTGTACGCTGACGCACCAACCGATGGCGTCACGGACACAATGG
AACGCTAGCTGAAAGGAATCACCTGCGGTCGTAATTTCGTAGCCTCGGAATCGTGGCAGTTGTTGTCGTAGCAAGTCATCGTGGATCGATTGCGCATCGG
CCATTGCCTGTGAATTACCAGCCCAAAGTCGACTAGAACCTTCAATGTCTGTGACCACGAAAATGGGTCGTCGGATAGGAGCTTCCACGATCACATCCAT
CGTATCAAGACCTAGTTCATCTTGGAAGTAGCCACCTTCGAGAAGCTGTTCATACACAGAGGATGACATGATAGGACGTAGAGCTCGATAGCAGCAAGTA
ACGCTGATACCGATCGCGAATGCAGTGCCTGCACCAGAGAGGTAGAAGAGAATCTGTGTCAGACCCACCCACTCCATCTTGATGTCGTCAATAAGGCGGG
CCAAAACTTCCACTATGCAGGACGGAAACACCAGCACACAGTATACCATGACAAAAGTTTTGATACGCTGGTGAAGCAGTAGTGACGCTGGGTCCACAGC
ACTTCGAGCACGTTTCTGTCGAGAAATCCATATCGTCGCATACACCGGATAGAGCACAGATACCCAAACACATGCCAACTCGAACCAAAAAGCAACAGTC
TGCACAGTTTCCGCCTTTGTGGACGGCAGGAACGCTGAAATTGCCATCAAGAGAGCAAACACAACTGCGATGATACACGCGCGAATGCAGTATTGCCGAA
TAATTGCACGCTCGCGTTTAGATCCACGGTCCATTGACTTGATAATAAGGCGCTTCAACTCATAGGCCAAAGTGGTGATGAAAAATGTCGTACACAGCAA
AGCACAGTCTCCGATTAAAGTAACAGTGACAGCTACCGCCTTGAACTCCTTCCCATCAGAGTAAATTGCTCGTGCTCCCATCAGCTCGCCATCGTCGAGT
GAATCCAATGTGTCTCGTAGTCCGTTAAAATTGGTCAACACACCCACGTAGAGCAGTAGTCGAGCCAGCGAGTAGATGAAGTACAACCTGCAAACCGAGT
AGGTGATGTACTGCACGGCCGAGTCGCCAACCTTAATGTGTTTGAACGAGAGCAACAGCGTCGTGACCGTCGCAGTCGTAGCCACCGCCAGCACAATCAC
ATACGTCAGAGTCCAGTCGTAATGTGTCGAATCATCCAT