Description :
From Genome Similarity Track
Location :
Scaffold_417:5004- 15619
Transcript NameFunction/comments
Phyag_g5535hypothetical protein
Phyag_g5536hypothetical protein PHYSODRAFT_471024
Phyag_g5537conserved hypothetical protein
Phyag_g5538hypothetical protein

Sequence
10615 bases(100 bases per row)
GGCTTGGTAACCGTGTACTCGCTCCAGTTCAAGCCTAGTATGTGGAGACGAGCTGTCTACCTTCATTGACGTAGCTTTGGACGGGGCCACAACAGCCCCT
AACCATGGCCGTACCGCCATGAATTCGTCACCAATATCATCGTTACTAGCCGCTATCTCCAATGGATCAACAGTCCTTTTACTAAGCAAGTCGATTCCAT
CGCTGTCACTATCAGTCTCGCTAGCGCGATGCTTGAAATCAACATTTCCGGCAGGTTGCTTGTCGTGCTTCCAGACAAAAATGCACCGGTCGTTTCCACC
GACAGAAATTATATAGCTGTCATCAAATGACCATCTGATGTTGGTGACGTGGGAAGAATGGCCGCGCAACTCGAGAGACGAAGCTTTTTCCAAGGCACAC
GGATATCGAAACACTTTCACTTTCCCAAAATCATCTCCTGTTGCCAGCAATTTCCCATTGTTAGATCGATCGACAGCATTCACATCTGTACCATCGCTTT
CTGCTTCCCAAATGCCTTGCACCGACCAACCCAATGTGCTGGTCATTGTGTGCCAAATCTCGTCTCGAAACGTTGTGGCATTTGTGACATGCTTCCCCGT
CTTAACTTCGGTGAATAAAAGCTCGTATCCACCCGATGTACTCTGTAAGAAGTTCCCGTCGAGGGAGAAGTCCATGTGGGTGATGTAACTCGAGTGTTTG
TTAAAAATATGAGTCCGAGTAAAACCCTTGAGGACGTTGTAGAAGTAGATTTTGGAGTCATGACTTCCTACCACCAGCGTCCGGTTGTCGGGAGAGAACT
TGACGTCGCTGACCCATCGTTTTGCATCAAAGCAAGGTTCCTTCACGCATGTTAAATCGGTTGCACTGTACACCACAAAACCTCCATTAGGCTGACGTTT
CTTCGAGTTGGCTGCTGAGGCCTTCGCTCGagatccagctccagctttgCCGGATTCCTCAGTGCCAAGCCCAACCGCGATCAATTTACCGTCACCAGAG
TAAGCGCAAGCACGTCCTGGGATGGGCAACTCTAAACTACCCAGCTCGTGTTGCTCTAAAAAGTCCCAAATGCGAAGTGTCTGATCATCCCCAACCGTAC
AGCACTGCTGTTTTGTCGGGTGAACATCCAATCCCCATAGTTCTCCTTGAAAGTGCCCCTTTATCAGTGCTTCCGAATGGATATTCTGGCCTGTTTTAGC
ATCGAGCTCGTAAATCTCCGACGCGAGTGTGCCTACAAGGATGGTCCGTCGATCAGGGgaatagcagcagcttcgaaTGGCTTTGTACTGAGGGAGTGAC
GACGATTCAAGCGAATCCTGAATCTGGATGGGAGTTCCGACTTGCTTTAACTTGTCATCCCACTGAACAATTTGACCATCTCGACCTCCCGAGAGCAAAA
GCCCCGACGAGTTAAACAAAGCCGTGATGGCTCCTTCGTGCGCCTTGACAACATTCATCAGCTGTCTCCCCACAAAGAGGTACAGACAGCCATCACTTGt
tccgacgacgacagccTGGTCCGTATTTTCGAGATATTGGGCTACAGGGAACGCCTGCAGAGATCCCTTCTTTCCCAGTACACCTTTTTTCGACACGAGC
TCTTTACCTTCAAGCGACCAGAACTCCACGTACTTTTGGCCACACATAACAAATTCACTAAGTGTTCTTGGGTTTGTGGTGATGTGGAATGGGGCCGCTT
TGTTGCCTTTCGCGGATATCTTCATTACGGCAGACTTCCAACTGCTTTTCGACTCATAGATTGCAATGCTGTGATCATCATCCCCTCCAATCGATACCAA
CAGTTCGGGCGTCAGGAAAGCTACTTGTAAGATCCCACGCTTGTGAAACCCTTGAATAATGCATTGCACTTCCATCGTGTCCAGATCCCACACAATGATT
TTGGGTTGTTTGCCAATTTCTCCGCTAGCTGCGAGGGGAAGCCGAGGGTGCAGGCACAAACTTAGCACATCATCAGTATGCGCTagatggtggcgctgtt
tgGTAGTTTTCGTGTTTAGCACAAcacatgctgctgcggctggatAAACGATCTCTTCATAGCGTCCAGCTTTAGCATTAGCCGTAGTCGCAGCGAAGCG
AACATTGTTTTTGCAATCTTGTGCACTGTAGCCAAATATCCAGTCCAATTGAACTGAGACTAACGGAGCACCTTTAGAGAGCGTCGGAGTTTTGCTTGGC
GCAACTATCGCCCCTATCCACGGCTTCACAGCTAAAAACATGTCACCAACATCATCCTGCATAGCGTTCACTAGGTTATCCGTGCTTACCAAAGGTTCCA
AAGGCTCAGAATGCTTTTCTAGTTTGGCTGCCAGTTCAACAGATTCGGCAATCTCCAACGACGTTCCTTCCTCCCCATGTTTCTCAGGACTTGCATCAGC
GACATCAAACAAGTCAAACAATTCTTTTGCTCTCTTATTCTTCACGCAAAATTCTCGAAATTGCTCACACGTGATCGTGATCGACTCCTGCTCTGCTACC
TTCTCTTTTAACAAAGAAGTTCCACAGTTTGCAATCTCTCGAAAGAGCGATTCAGCGAGCAAAATaatctcctcttcatccaccaccGTGTCCATGTTTG
CTGCCCTGGTGGCAACATTTATTGAAACCGGCTGCAGTATCTTCGCCAGCCCCGATAGCGTCGACTTCAATGAGATCGTGAACTCATCCAGATCCAACGC
TGCGTCCTCCGACATATCCCACGAATCAAACAACAAATCAATCTTCTCATCCAATGGAATAGCTGCAATAAACGCAATAGCAGAGAGGAACTCGAGTGCG
TCGATAGCTGCCGAGCTATCATTCAGGCTCTGATATTGCTGACTCAGACCTCTTGATCCcggctgcatctgctgccaCCGTCTCTGCATCAACGAGTCAG
AAAACAACTCAAAGGCAGCGTCTGCATACTCTGCGATACGAGAATTGGAGCCATGCAAGCTGGAGACGCCCGAGGCGACTGCACGGCAGCAGATGGACCG
CAATTGGTTTCTGGACAGCGCGAAACTCGTCGCCGAGTCGTAGAACGCGCGCCAGAACGCCTCAATCTCATGCTGTCGAAGGTTGTCAAACGGTAGAATA
GCACCGGCCAGCGCCATGGCCTGCCGGTCCTTCACAGCCGCCAGTAACAGCGCGTTGCCCATGTTGACACACTTGGACTGGTGATCTTTCGCGGtctctt
caacttcatcaatttcagccaatgaaaCTGCAGCTGATGTGTGTGTACGAGTGATGTGGTAGACAAAAGCGGGAGAAATCCGATGGGCGCCATTCAAATA
CCAAGACAGAGTTCACGTAGCGAATATGGCCGACATCCAGAACTTCCAGACCTTCGGTGCGTTGCTATGGCTGCAATAGAGCGACGTTGTAGATATGACG
ATACTGGACAGATGCAGAGCGTTGTGCTGATATGTTTgccgcttgttgctgtgctCTGTAGACGCTTTCGCTGACGCCAAGGACGACTCGAGCatcggcg
gcggcaaggTGCACGtgcgtgtgcagcagcgtaACGGCCGCAAGTGTCTGACGACGGTGCAGGGCCTGGCCGACGACCTGGACGTGAAGCGCATCCTCAA
GGccttcaagaagaacttcaGCTGCAacggcgccatcgtcaaggacgacgagctgggCGAGATTATCCAGCTCTCCGGAGACCAGCGGACCAACATCCGC
GAGTTCCTGCTGGACCAGGAGATCTGCACGGACGCCCAGGTGGTGCTCCACGGTTTCTAAGCTGGTAGAGCTTTTTAGCTTTTAGCTGCTGCGGCCAGAC
GTCTGCGAGCTTGTGATCAAGAAAGAGTTAGATGAAGAGGGAGGAGGAACCGGGTGGTAAACACACCTCGTCTTCCTGTTCTCTCAGCGGCTGTTGAAGG
AATATATTTGATGCTTCACTTGTTAAAAGAGAGTGCTGTATAGCAATGCCATTGCAGCGTACGAGACGCAGTCCATACCCGCGACTTTTCTGCCGGGAAC
AGCATCAACCTCAAGCTACACCTCTCTTTTCtagcagcatcgacgtctACATGCGGTCGGTGATCTTGAACTCGGGGAAGTCGAGGTCCGGCTGCCAGAT
GCCCTGGATGGTCGGGCGCTTCGAGATGACCGGCTTCTTGATGTGCGTCATTTTGCGGCCGCTAGAGTTGCGAAGgcgctccagctgcagatTCACACCA
CAAAACAAATATCGCAAACCGAGATAAGTTAGAATACGCAACAATAGATAGCGAGAGTATTTGTCTGCACATGCAAACAGTGTCAAGAACTCCGAGCCGC
ACCTGCTTCATGATGAAGGGGATGTCCTGGTTCTTGACgtccgccaccttctgctcATTTGTCACTGCAGCAATAACACACCCACCACAACACTAATTAG
CACCTCCCTTTAACATTTAACCCCCGTACACCGCAATAATCCGCAATAAAACCCACCGTAGTCGCCGACGATGATCGGGTGACGCGCGCCCTTGAGCTCC
GTCTCGAACTGCACCTGCGggttctcctccacgaacttgAGGAAGCGCTCGTCGCCCAGAAGCTGCCGCACGTAGcgactgctgccgccgtGCTGGCAGT
AACGGATCGTCACCTGCTTGAGCTGCCACACACCCTTAGTCGCCATCCCGTCTATTGCTTGATCGTGCGGTCAAGAGTGAAATCGTTTGGCTTTGGAGAC
AGTGATGTGCGATACCTAATATAGCGTGTCACACCTAATTGAAAcgcagagtgatggtcttccGCAGTCCACAGTGGCATTTCCACATGCACATTGTTGC
CACTCGTGCGTCAGCCAATGGCGACGCCGGAcgccgagaagagcgacgtgGACAGCTTATTGCGGCTCGTCCGCGCCCACCAGCGGCAGCATGACGACCG
CGCGTACGACTCGAGCGCTCCTGCCGCCATCCGCCGCTGCAAAACGATGCTGACGAAGCtacggaagctgctgcccaagCTCATGCGACCGGTAGCGACG
CTGTCAACGGACCAAGCGGTTCCTGTCTTGCAAGATTTATGCCAGTTACTGACGTTACTTTTGGGAGGTGGTGCGTGTCCGCACTCGATGACGCTGTTCA
TGGAGAGCAACACGAACGTCGCGCGCTCGTACCCGACGCTGGCCACGATGCTGTTCTACATGGTGTCGTTCTACACGAACGATAAACTTTCACAGGCTCA
ACGCGATGTGCGCAatgtgacgctgcagatgatTTTATTCCTGCAGAGAAACGATGTCTACGGGTTTATTCATTTCTTCCGTGATACAGTGCAGTTATTG
GAGGACTGCTTTCTACTGGAGGAGTCATTGAAGAATAGAGGCGCGACGAGTTTATTGCCAGGAGGAGCGAGCATTGCGTGCTATCTGGATGCGGCGATTC
ACGTGTATCAAGATGCTGATGGACCGTTAGGAGCGAAAAGCAACGTTACGTTGTGTGGCTGCATGCCGATTGCAGATGTGAGTCAGCTTTATGAACGCAG
AGAACAATTGAAGCAGATGCTGCCGGCTATTCAGGTGAATTCGTACGAGATGGTGGTTGGTCTTCGACAATCTGTGGTCGTTCTAGCGGATCGGATTGTT
CGCGAACACAGCTCGATGTTGGAAGGAGACCCGGCGTTTGACAGGTTGTGTCAACTGGTGGAGTTATTTATTGGTAAGAatgaagcgctggagaaaAGTG
CGCAAGACGCAAAGTttggtgacggtgctgtGTCTAGTAAACATGTGGCTGATGTCACTCGAAGCACGCTGCGACTACTGCAGACGATGTTGCAATCTAG
TGTGGCCATTGAAAGACGCTTTGTTCGCTTGGCCCTGGTGTTCTTGAAGTCTGGTTGTGTTCACGAAACAAAACCACGGATATTGAAAGCTTGCGCGGCC
ATCTTTGAACTGATTAGAACGACTTATCCGCGTCTGTCAAAGTTTGGCACTGACGCTTTGTGGCCACCGTTCGAGCTGTGGGTTTCTGAAAATATGGATC
TGGTTCGCGGTGCGAATCGTGAAGGCAGAAACAGTATGGAGATGATTTGGGTGGTGGTATTTTCGATTTTGGGTGCATACACTCGTCAGTCCAGTACGTC
GTCCCCCGCTTCACTATTCGTGGATCTATTGGAATGTGTCGACGTACGAGCGTTGagtcctccagctcgctcCAGCGTGATCGCAGGCATCCATGGTGTA
TTGTCGACAAAAGAAATTCTGGTCAAAATGGTTCGTTACATATCGGAGGTGCTACTAACCGGTGGACCTGACATGGCGCGCTCAAGTCAGCCCACTAACA
CAACGAGGAAACGAAAGAGGAATGAAATATCTGTCAACAGGCAGAGGTCATCTTCAGGTATGAATGATGTGGATAATTCTGAGGTTCACGAGAAGTTAGG
TAGCTGGATGCTTGCGCTGATATCGATCGGGAGTGGAAGCGATCGGAAAAGCATAATTGCCATGTCCACGAGTTTGCGCGTGATTTTGCCCCTTCGACGG
TATATTGTGGCCCTAGTACCTGTGGAAAGTCTTGCCATTtttcgagctcttcttcagcgcgtCGATTTGATTCTAAACACATATGCCCCATCGCTCACCC
CGCCTACGGGTGAATACCTGGATTTATGGCTCATTCTGCTTCGATATTTTGACGATCACGAACTTGAAAAGTATCGGGGTCTGCTGACCAGCGTTGTCGA
GAGTGTCGAGACTCAAGACTTTTTCGCGCATAGCGTCGAACGGGACAAAACGTTTACAGCTCCTACCTGTTGGGATTACCTGGAATTCTTAGAACTGTAC
CAGCGTCACCCCAATTGCCACGACATGTCTCCATCAGAAAACTTAGACGAAGCATCGTACGATTTCCTGCAAAGCGCAGACTCCATCCTCGATGCAGTTT
TCCGGCAGTGCGTAGCCCTTCGAGGTCCTTTCTTGGTGTACTTTGTGTGGTCACGCCCTCCGATCCTGAATATTGTCGACGAGGATTCTTGGCGAAATGC
CCTCCCATGGAAAGTTGCCTACCGGGCAATTTTGCAAGAATCATCATTTGATGCAGCAGTATGCTCGTACCTCGCAATGACTCCTCTCCTCGCGTTCTTT
GTCGTTGGAAACAAGTTGACGTCTCcgaagaagatggctacatgcaTTATGGAGGCTTTTAGCAGCAAGTTTCAGCGCACGGGGTCGGATTTGATTTCGT
CGGCAATAACGCAAGCGTGTGGAGCAGTGCTATGTGCAACCGCCTACGGCCAAGCAAACGCTGATGGAGTCCATGACGCTGTCGATAGAAAAGGTGATAA
TCTTCATTGTCGCAGCACAAGTTGCCAGTGTCGTAAGATCACTTACAGCTTCCAAGCAATGCCAATTCCATTAGGTTTATTTGAACCTATAATTCGCTGC
GAAACAGGCACTACTACCGAAAGCGCGCAGGTAGTACAAATCAACGCAATGTCGAGTGTTTTTGAGCATTGTGAAGTTAACAATGGAAGAGATCGGACTG
CAGTTCGTTTCGTGGAGCACCTCCTAGCGTTGTTTGAACAGCACTCTGGGGTCGTTCGTCAAGCGGTGTTGGAATCGGTTGTTCGACAACCACGACTCCT
TGATGCAATGATTGACCCGGCAAaagatggcgttgctggactGATGGAGCGCTTGGAGTCTCTTATTACGGTTGCAGAAGAAAGCTCTGATGATACGGTA
ATCACGTCGGTGATATTGGCTTCGGGTTCCATTGGGTGTGAATGTGATCCGCATCAGGGCGATCGTGGCGACAATTGCATGTGGATTCTATTGCGACTGG
TTTCGCTCTGGAATCGATATCAAGTTGCGAATCGAGCGCAATATGCAGGAATGGCGTACGACCAGATTTGTCGCATCACGGCGCACCATCGGGTATCGTG
GAGGAGACTCTGTGTTGATTTTCCCGAGTTGCTGTACTTTTCGCTTGTGGATGATTTGTTGGAAACTCGGACGCTTGGACTGTTTCTTAGTACCTTTATG
GGTGGCAAACTGGATACAAAAGTTTTTCTGCGTGCGAGTGCGCCATACGTCCTCCCAAAGTATATTGTCGACCAAAACGAGCGGATGATGCATGCGTACG
TCGATGAATATAACAGGACCGAGAATGATATTGGAATGGGTGATAATGATGGGGAGCCTCCGACGACGATAACTACCCTTCTCATGAATCACATTGACTA
CGTGCTGAAAGATCTGATAATTCATCAAGTGCAAGCACTCTCGAACAAAAACCGCCTGGCAGAATGGGAGTTTTTATTCAAATTCTTGCCGGAAAACTCC
ACGGTTCGCGATGTTATTACGCATTTTCCTCTACGGCTAATGAATTTGTTGGCATGGGAGCTTGGTGGGCCACAGTCTCGTATGGCAAAGCGAGCGATAC
GAGAAGTCGCAAATTGCCTGAGTGAAGGTTCGGGGAAGGCGGAAGACTTAGAACTGACCGCAAGTCAACAGCCGGGCGAAGGGTGCATGCCTCGCCAGTA
TTTTATGGCACTTATGACGGACCTAGGCAACCGAATCAGTGGGGACACTCAGTCTGCTACTAAGATTCGGGCGATTAAAAGTGTTGACCGCTTGCTCGAA
CTTTACTGTGGCTCTGCTGGGGAGTCGGATGCCACGCAGAAAATTGGAGTTGTCGATCCTTTTGTCCCAAAAGTGATGGCAACTTTGAAGGTCGGTCTTA
CGGAGCGTGAATTGCAAGAATATGCCATTCAAGCGTGGGCGAATTTCTTGCGAATGCTGTCGACGAAAGCTCTAGAGGCGAATTTGAGCTCAATTGTAGT
CAGCCTACTCTCATGCCTTGGCCACGAACCCTCAGCAATCTTGATTGAGGATGGATCGGTTAGTGGTAGCCAATGCTGGAACGTCGAATCTCTCGAACCT
TTTAGGCAGGATGGTCTTGGACAAGTCAACACACCAGTCAGTCGAGACGAAACCCAAACGAAATGCATGACGGCGGCAGTGGGTATTCTACGATACTTGT
TCATTGAGAAGAGAGCTGAATTGATGCCAGCGTTTCCGAAGATTCCGTTGTTGCCGTCCATCCCAGAACTCGATGAGATTTACGTTGTCCTGtacgaaga
agatggagatccgAGAAGTCGGCCACTTCGTGATTATTTAATGAACCTGTCATCCTACGTCAATCACCTTGATGTAGCTGTTCGTGAAATGGCGCTAAct
cagctgctgcgatgTCTGGTTGTGCGTGGCGCTGAGTTAGAGGAGCTAATGCAGAACGAAGGAGACATATTTATCGACAAAGCAGTTGCTTGCGTGGTGC
AGTCTGTTTTGCAACTTTCTCGTACAGAGAGCAACGAAACTATCAAGCTCCTCTGTGCTCGATGTTTGGGAGCGCTGGGTGCAATTGATGGTGCCCGCGT
GCCGTTATATATGTTTTATACTGCTGGTGGGCCCCAAGGAGGTGTTACAGTCGCAAAAGAAAAACAGTGTCAAAAAATGGAGTATTCGACGAAAGAATTA
GCATGCGCACTGATCGAAATATGGCTGGTAAAAGAGTTGCGTGCAGCACCCGAGAACACGGATTCATTAGGATTTGCGATCCAGGAACTGTTAAAGTTTC
TGGCAGAACTCACGGCAGATCCTCAGCATAGCGGTCAAAGTTTGGCGTCAATAAACTCTTTTGGTTCGTCGCACAAGGCACAACAAGGCCCCAGTGCTCC
AATGCCAGATTGGATGAAAAGAAGATTTGAACGCAAAGAGGTGCTTCAGTTTATTGAACCGTACTGGTCAACAAACTACGGTGTGTCTGGTCGATCGTCa
cgcaatggcagcagcaatggaacAGACCGCCGTTCCTCGGCAAGCACTGATCGAAGTCTGCATCCAGCCCGTGATGATATTTCGTTTTATGAAAAGTACG
GGACGTCGTATGAACAATGGATATTGATGTGGTGCCGACGATTGATTCATCTTTCGCAACCACCGGAGAGGAAAATTTTTTGGGCATGCAAAACTGCATT
AGCAACGTGCCCTCAAATATGCCGTTTTCTGCTGCCGTATCTGATACAAAATGTGCTTCGATCCGGAAGATCTGAAGTTGGCGAGGAGCTTAAGAAAGAA
GTCATGGCGGTTTTGGACGACCAGGACTGTGGAGTTTTAATGGATGATGTTCTGATGGCTCCGCCTGAATCGGAGAACACAAACGATTCCCTGAACAGCG
GTGGCGGGGCGTCTGAAAGAGCCATAGGCGAATTTTTCCGTCGCCACGATCAATGCTCCCAGACAATTTTCTCGACAATTGATGAACTAAACGAGTGGCT
TTGGGCCAGCGAGAAAAAGCGTCTTGCCCTGAGTAATAGTGCTGCAAGCCGCCAAACTACTGCTTCGGCTCGTAGCGAGGGGTCTTCAGACGTCGATGAC
CACGAGAAGGAGTATCTGGAGGAGTTTCTGAAAGAAATCCCCAGTCGGTCACTTTCGAATGCAGCTTACCAAATTAAAGCTTATGCTCGAGCAATTCAAT
ATTTTGAAGTTTATCTACGGCAGCGAGAGGTCGACCCAACGGAAGCACGGCACAATAATGCTGAGATGGCCGGCCCAGTCCATCTTTCTTTGATCTCAAA
AAACGCATTTTATCT