Description :
From Genome Similarity Track
Location :
Scaffold_72:50039- 51857
Transcript NameFunction/comments
Hyaar_Emoy2807965hypothetical protein

Sequence
1818 bases(100 bases per row)
TCTCTCCGACCTGATATGTCGGAGAGGTAGCTGCGAGAGCTTCACTTGTCCATCTACTCTCTGATTAGTTATAAATATAGCCTTTGTCCGATTTGACTCG
CTAATAAAGGTTTTATATCACCACGCTCACCCAATTGGTCAATTCGGTCAATACTTTTTTCAAGCGCGGTCGGAGTTTTAATGTTATATTTTGGGGAGAT
GAAAATGGCCCATTTTTTGTCACGAAAATAAAATATGCCCCAGGTAATTAGAAAAATGCCCCACGTCCTTGTATACTCAAGTTAACGTGGTACACATAAA
AATTATGATCTTTAGTCAAATCGCGATTCCCATTGTACGGCTGTGCTCGACCCCCTCCCTGTAGGGGGAGACGCAGAGGGGTTCTGCCGCGGGCGTGCTG
CACACCCATCCACCAATTGTGGGCGCGAACGGCACAGTAAGATGTGAAAGCGTCTCTGTATCGTCGGCCGCGGCCGCAAAGGTAGACAACCGGTGCTGAT
GTCGTTACAATTAATAGCATTGTTTTCTATCGTTTTTATTAATGTTGTTATTGTTTCTAATGTTATAATTGGTACTATTGCTATTTTGGGTCAGTTGCTC
ATGTCATTGTTACTGCTACCGCCGCCGCTATAGCCGTTGTTGGTGTAAGTTTTGTATGATGTTCCTGTTGCTTTTGTTCTGCTGCTGATGCTGCTGCTGG
TGTTGCTGACGTCATTGTTATTGTTATTGTTCTTGTCGTTGCTTCTGTTGCTGCTGTTGGTACTGGTGTAGCTGTTAATTTTGCTGCTGCTACTGCTCCT
TTGCTACTACTGCTCTTGCTACTGATGTTAGTGTTAGTGGTGTTAGTATTGTTTTGTGATGTTTTCGGTACCGCAGTGCTGCTGTTATAGTTGGTTTGGT
TTTGGGATAGGAAATTCCTTTCTGCTCGAATGCTATAGTAACACAAAGCATATTTAACCATTAAATAGACTATAATGAATCCATTCTATCTGTTTGACTC
TCATTTTACTAATTTAAAGGCTTTACCAGTGCTGATGGCGACACTTCAATGCTGTTGCAGGGATTGGTTGGTGATGTTAATGATTTTAAACTTAAAGGAT
AGCACCTTGGACGTGGAGAGTTCTTGGGGGAAAGAAAGTCAGACGTATCAGCACATTGCGTGTGAATGGTGATTATTGCGAGCCCGAAATATGAAGCTAT
TAGTGAGTGTGCGCAAGGTTGAATACCGAACTTTTAAATCGTACTTACCTGTGCGTGTGTCTGTCTGTTTGTAGATAACGCGGTTAGGTGTACCTTTCAC
GTACTAAGTGCGAGCTAGCCTGTCCCCCCCCCGTAGGTATAGGTATATCCGAAGTCACTCTTTGGCTTATTCGAAGTCACTCTTTGGCTTATCCGAAGTC
ACTCTTTGTTTATGGAAGGGGAAGGGCTGGCTTTCAGGGGCTAGATGCCATGCATTGCTATCATTAGGCCCCTGAGTGGTACCAACGTACATCTGGGTAC
CTTGAGAATCGACAACTCGACGGGGCTCTACATCACCGCATCCGCTAGACGGTGAATGCCAAGTAAAAGGCGAGATGGAAGATCCAGCATACTCATCTTC
ATAACGCAACATACTCCGGTTGTGCCCATGTTTCTGACTACCTGCTCAAGTCCCATTTGTAAGCTCGTATTCCCACACCCAATAGACTCGTGAGACCAAA
GGTGTCAAACTAATGAGTCCCGATTGACCGGCAAGACTGTCTCTCAGATCTGAGCTCAAATTGAACGCAATCACCCGATCCAACACGATGACCCCCCCTC
GTGAATCTNNNNNNNNNN