Description :
From Genome Similarity Track
Location :
Scaffold_37:500323- 505961
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13964hypothetical protein
Phypa_INRA-310PPTG_13965hypothetical protein

Sequence
5638 bases(100 bases per row)
CCCGTTACATCAGGTAGCACTTCGTAGTCCGCCCACACGACCATGAACGTGAATGACGCTCCCAATTTTAACGAAGGGGCCGGTGCTGCCCTTGAGCACG
CCAGCTTCCCCCACTTATCCGTGTTTGAGTGGGAAGCGCTTCACCGCCTCGCCGCGGTGTCCGGAGAAGGAGTCATCAAGACATTGCTGACTGACGGTAC
GGAGACTGACCAACACCTGGCTGCTCATGAGTTCATGGCGCGTGAGCTCGCTGACCTGCGTCGGCGTGCGACGACTCCCACGCCGACCACGAACAAGACC
GACATCGTGAAACTCGATGTCTCCAGCTACAGTGGCGACGGTGACGCTCGCCTCCAGTTGAATCGCTGGTTCTGTGAGATCGACACCGCGATCGAAGCTC
GGCAGTTGTCTACCGAGTTTGCTCGTACCCGGTTCCTCTTGTCCAAGTTGACGGGGAAGGCCAAGGAATGGGCGGTCGGAAAGCTGGTCGCCGACGCCTC
CTGCTTCTCGACGATGGAGTCACTAAAGGGTGGACTCCGCCTGGCCTTTGAGCCCCCTCAGGACGAGCGTGTCCAACGCTCGGCTTTCCTGTCTCTCAAG
CAGGGACGGATGTCCATGCTTGAGTACATTCAGCGGGCACGACACCTGGTGTCGTGCATCACGACGAACCCGGTGGACATGGCGACCCAAGTCCATGTCT
TCATCTCTGGTATGAACGCAGGCTACCAGCGTTTCTATCTGACCAGGAAGCCACCAGGATCACTCGAAGAAGCCTTCAAGACAGCACTACGTGAAGATTA
CAGCGTGTCCGCTTCCGAGGCGTTCTCCCTCGCTACCCCTTCCGTCACGGAGCCTGAGCCCATGGAGCTTGACGCCATTCAGGATTACCACGGGCGCCGG
CGCTCCAGTCCGGCGCCAACGTCGTCTGCCCGACCACCTCTGGCGGGCCCTAGTTGAAGCACTCGCCACATGCGATGCTTCCGCTGTCGCAAGCTTGGAC
ATCGCGCGGCTGTGTGCCGCGCTCCCGCTCCGGTCTTGGCGCACGTCGTCGCCGAAGACGCTGATGCTATCGTCGCCGAGTCAAAAAACGGCGACAACCA
GTAGGCGCGGCCCTACTGGTTGTGGAAGGAGCGATGGCTCTCTGGTGGCAGAGCCTCCTCCTAGCCCTTCCGTGCTTCGTGCACACCTTTTTGTCACCAT
CTCCAGCAGCGACTCGAGACTGATTGTCCTTAACGTCCACGTTGATGGCGCGAAGCGACCGCTTCGCGCGCTGCTGGATTCGACGAACAATTTTGTTTGC
GCCGACAGTTTGTCGGTGTTACCGGCGGGTCTGAGCTTTCGCGAGGGTCCGGGCGAGATGATCGTGAAATACGCGGGTGGCAAGCCGCGGCGGATGCCGC
AGCGCTCTACGACCTTCATGTACGAGTTTGACGGATTCCGAAGCTCCGAAGTGTTCCTGGTGATCGAGCTGAGTGGCTCGTTTGACTTCATCTTCGGCAT
CCCATGGCTCGCTCGGCACCAGCCTGAGATTAACTGGCTGACCGGCACAGTCCACCCACGTGACATCGACGTGAATGCAGTACTGGAGTTCTTGCGCGGA
ACGCCGGACCGATGGCCGCATGTTGCAGTCATGGACTCCGACTCCATGACCCATGCCGCACCTGACGTAGGCGATGGCCCTTCGTGTGCGGCGTGCGAGC
ACGCATCTTGCGCCGGTCATGAGTAGGTGACTCAAGACGCGTCTGACGTGGTCGATCATGGGTTCCCACGTCCCGATGAGCAGCGGCTCTCGGCAGCAGA
CACCACCGTGGTTGAACAGAGGTTCCCACGCACGGACGAGCAGCGGCTCTCCGTTGAAGACGAACAAGAAGACGTGGCTGAGCGTGGTCTCCCACGTGCG
GTCGAGCAGGGGCTCCCGCATGTGGTCGAGCAGGGGCTCCCGCATGTGGTCGAGCAGGGGCTCCCTGATGAAGTTGACGCCGATGTCGTGTCCCGGCGTC
TGAGTACCGCAGACTTGGTCGAGCGTGATCTCCCACTGCCTGCTACGGAGGAGTTTGCCCGACCAGTCCGTCGCCGTGGTCGCCGCCAGCCTCGGCGACC
CCGTGCTCCACCGTACGAGTCAGACGCGTCTGACTCCGAGGTCATCGCCGTTCTGGTGGGGGGTGACGCGGCGACGAACCCGCGTAGGTGCGACGTTGAG
GTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAACGCATCCGAGATCACCACGTTGTCTGGCCTGTCGTGGAAACGCTTCCTCCACGACGTGAAGCATGGTGAGATCGAGCAGGTTTGCATGA
TCATCGCGGACAACACCGCGACTATTGCGGCGGTTGGTACTGATGTTGATGCTGGTGCCCCAGTGTCCGACGCCCGGGAGCGCCCGAACGGCGCTGAGCC
TAAGTCCGCCCGCGAAGCCCGCTATTTGGCCCAGTCGTTACCGGCACTCGAAGCCGCCGGCAACCCGGTTGCTCCGCTGGTTCGCGAGTTCATCGACATC
TTTCCTGACAAGGTCCCGGCTGAATCCCCCCCGATCGTGGTGATCGGCACGAGATCGATCTCGTGCCCGGCTCAAAGTACTGTGTGACGCGACAGTGGCC
GCTCCCCCGTAACCAAGTCGAAGCGATTGATGCGTTCTTTGAGGGTCGCCGGCGAGCCGGCCATGTCCGTGAAAGCCTTTCGCCACATTCCAGCCCGACA
TTCTGCGTGAAGAAAGCGACGGGTGGGTGGCGCATCGTACGCGCCTTCAACAAGCTAAATGACGCCACCATCCCGGCGCAGACGCCGATCCCGCGGAAGG
ACATGGTGCTCGACACGATGTCAGGCAGCACCGCGTACAGTGCTATCGACCTCATGGACGGCTTCTACCAAATACTGATGCGTGAAGAAGACGTGCCGTT
GACTGCGGTCAGTACGCCCAGTGGCATGCTGTGGGAATGGCTCGTGGTGCCACAGGGGCTCAAGAACGCCCCTGCCACGTTCAATTGCATGGTGTCCAAT
CTACTGCGTCCGTATCGCGACTTCGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGAGAGCGGCACGACGGATGTCGACGTCCACCTTC
TACACCTCCGCAAGGTGTTCGAGGTGATGCTGGCAAACAAGCTGTACGCCAACTTGAAGAAATGCATCTTCTGCGTTTCCGAGATTCCAGTACTCGGGAG
CTACGCCAGCAAGGACGGTGTTCGCGCCGACCCAGAGAAAATCGCGGCGATCTGCGCTTGGCCAACTCCGCAGGACCAGAAACAGCTTCGGCAGTGGCTC
GGACTCGCTACTTACCTCCACCACTACTCGAAGAACTTCGCTTTGACTATTCGGCCGCTGTCACAACTCCTGAAAGCCGACGCCACGTGGTCGTGGCGCC
CCGAGCATCATGCAGCCTTCGACGCGGTGAAGACCAGCTTGTCCACCGCGCCCGCATTGATGCTTCCGGACCATTCGAAACCCTTTCACTTGGTGTGTGA
CGCGAGCGACTTTGCCATCGGCTGCGCCTTGATGCAGTTTGATGATGATGGACGCGAGCGAGTGGTAAGTTACCAATCGCGTCAATTGAAGCCCGCGGGG
CGGAATTATCCGGTCCATGACAAGGAGTTGTTGGCGATGCGCTACGCCTTCATCAAGTTCCGCGTGTACCTCTTGGGCGAACAGACGTTCGTGGTGTACA
CGGATCACGCTTCGCTTCAGACGGCGACGAATAGCCCTCATTTGTCCCAGCGCATGGCGCGCTGGTTATCACTGTTCTCGGAGTACAACTTCGTCGTTCA
CTATAAGCCGGGCAAGACCAACATCCTTGCCGACGCGCTCTCGCGTCGACCAGATTACGTGCAATCGGGCCGCCATGCAGTTGGCGACAAGGATGACAAC
GATTGCGCTGTGTGCACCACTGATGAAGTCGCTGCTGTTAATGTCGCAGCGACCACTCCGCTTCGAGACCTGATTACAGCTGCGTACGAGTCGGATGCGG
CGTGCTCCGAGTTGGTCAAGTATCTGAGAGAACCATCAGAAGCGGCGCGGCGCCTCTTATCCCCTCGCAGCCGCGCCCGTGTCGATCGCTACAGTCTCGA
TGGAAATCTGCTGACCTTCCGCGTCGATCGTGAGGAACCGCCACTTCCCGCTTGACGATGATCTCAGAGCCCGCCTGATCCATGAGTTCCACGATACGCC
CAGCAGTGGTCACCTCGGGCGCGAGAAGACCTTCGCGTCGCTCTCGCGCGACTTCTACTGGCCGCACATGTATAAGTGGGTGCGGAAGTGGGTACACTCG
TGCGAAGCGTGCCAACACGTGAAGCCAACTCCGTCGAAGCAGGCCCCGCTTCGACCTCTCCCAGTCGCGACGGGTCCGTGGACATCGGTCAGCATGGATT
TCGTCTTCGGTCTTCCGCGAGATGCCCACGGTCGCACAGGCATACTTGTTTTCGTCGACCGATTCAGCAAGATGGTCCATCTTGCCCCTGTCGCTTCCTC
GATCACCGCATCTCAGTTGGCAGCGTTATTTCTCGACACGGTCTATCGCCATCATGGACTGCCATGTTCGATCGTCTCCGACCGAGATCCGCGTTTTACA
GCGGCCTTCTGGACGGAACTCTTCAAGCTTGTTGGGACGTGGTTAGCTATGTCCACCGCGTCGCACCCCGAAACGGATGGTCAGACTGAACGCGCTAATC
GGGTTGTCGAAGACATCTTGCGGAGCTATGCCACGTCGTTCACGTCGTGGAGCTCCTTCCTGCCCATGGTGGAGTTCGCCATCAACAATACCACTCATGC
GTCAACGGGACTGACACCATTTTTCGTGAACTTTGGCCGCCACCCCCGAGTTCCGGCGCTCCTTGGACTGGAGCGCCCTCCTCCGTCTCAACTGCCAGGG
TCCCACGACGATGCGACTCCCACTTCCACTGGTGGCGCCCCCACTGAGGCGTCCGAGATGACCGCTGACTCACATGTGAACGCGGTGAGCACGCGATCTT
CCTCGCGGATCTCCAGCCAGGGCCCTCTTACACGAGCCGCCGCGCGAGCGGCGACTGCCTCTCCACGAGACGTGGCCGCCTGGACCAGTCGGACGCTGAT
TAACCCGCGTCAACGTCGCGCCGTCGAGCTTCACGCCGCTCCGGATCCGGTCACGGCTGCCGAGGTGCCGCCTGCGACTTCGCGCCCACCGAGGCGCCGC
AGCGGGGGGACGCTGCGGCCGTACAAGAGTTCGTACAACAGCGCGAGTCAATTATCCGCTACGTCCGCGACGCGATCGCTGCGGCCGTCGATCGCCAGAA
GGAGAATGCCGACCACCGTGGGCGTCGTAACGTGGAATGATTCCACGTTGGAGACCAAGTCCTATTATCTACCAATGGGATTTCCCCAACGCTTGTGACG
AACTTGGGCGCAAGCAAGCTTGCGCCACGGTATATTGGCCCATTCAAGGTGATGAAGGTCATTGGAGATGCTTATCGCCTACAACTGCCATCTGCACTGC
GCCTACATCCTACCTTCTACGTCGGTCGGCTACGCCGT