Description :
From Genome Similarity Track
Location :
Scaffold_18:500323- 501752
Transcript NameFunction/comments
Physo_114112hypothetical protein

Sequence
1429 bases(100 bases per row)
GTGGCGTAAAGCAGCTAAAGCAGAATACAAGTCCCACATGGACAACCAAACTTGGGTTCTGGTACCCCCTCCGAAAGGAAGGAAGATTTTAAACTGCCGA
TGGGTCTTTGTAGTAAAATATACCGGTACAGGCGAAATTGACCGCTTCAAAGCGCGTCTAGTGATCAAAGGATTCCTTCAGGAACATGGCATTGATTACA
ACGAGATTTTCTCACCTGTTATGAGGATGGAGGTACTCACACTCCTTCTGACCATTGCAGCGTTGCTTGATCTTGAAATCCACCAAATGGACGTAAAGAC
AGCATTTCTCAATGGTTTGCTAGAGGAGGAGATCTACATGGCTCAGCCGGAAGGTTTTTAAGTCCCCGGTAAGGAGCACCTAGTGTGCAAACTCCTAAAG
AGCTGTACGGATTGAAACAAGCTCCCCGTGTATGGTACAACACGTTGTATGCCTTCCTTGAAAGCCTAGGGTTCCACAAACTCATTAAGGACAGCTGTGT
GTTCAAACGCACGGTTAATGGTGTTACATGCTACATTGCTGTGTATGTTGACGACCTCCTGATCATTGCGCCTACACCAGCCCTCGTAAACGAGTTGAAA
TTCGCCCTGAAAAAGCGGTTCTCCATGACAGATTTAGGGGAGGTGAAGTACTTACTCGGCTGGTCTATTCAACGTGACCGTAAGAACCAAACGATCTTTA
TCCACCAACACAAATACGCTACGAAGGTCCTTGACCGCTTCAGCGACTACATTCCGTACCCTATAGCAACCCCAGCAGATCAAAACTTTAAACTCTCCGT
AAGCAGCCAGCCTAATAGTGAGGCAGAGAAAGACGCGATGAAAGATATTCCGTATCGCGAAGCCGTTGGTAGTATCATGTATCTCATGGTAGGTACGAGA
CCCGACCTGGCATTCTACATGCGTGAGGCCAGCCAATTCCTAGCTAATCCGGGAATGGAGCACGGGAAGCAGTAGTTAGAGGTCTGAAATATCTATTAGG
GACTAAGGACTACGGTCTTCTCCTTGGTGGATCTCTCGATGTCACACCCGAGAACCTGGGCGACAAGCTGACAGCTTACAGCGACTCTGATTATGCCAAC
TGCCCCGACACGAGACGGTCTGTCGGTGGATATGTGACTATGCTTGCGAACAGTCCTATCTCATGGCTTTCGCGCAAACACCACACGGTGGTTCTCTCTA
CAACAGAGGCAGAGTACATCGCTCTGTGTCACTGCATGCAAGAGATGATTTTCCTCAAACTGTTCGTTAAATAGTTAGGTTTTGGCACAACGCAAGCAAA
TGTTATTCATGAGGACAACCAAAGCTGCATTAAGATCTGCTATAACCCAGAACTACACAGGAGGTCGAAGCACATTCATGTTCGATACTGTTTTGTGCAG
GAAAAAGTCGAGCGACACGAGTTCTCCGT