Description :
From Genome Similarity Track
Location :
Scaffold_12:50027- 51897
Transcript NameFunction/comments
g4912.t1hypothetical protein

Sequence
1870 bases(100 bases per row)
GAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGTGTGAGTACAAGATGTACTCCCGGACGACATTCCTG
CGGAGTTACCGCAGGACAAGGGTGGTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGT
CAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAAGGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCA
CAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGA
TGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTCC
GAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGC
GACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATGCAGAGCATCTCCGCAAGTTGT
TTGAGCTCATGCGAAAGCACAAGCTCTAGGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGG
CGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTG
TGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTGAAGAAAGAAGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCT
TTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGAT
CGGATGCGCACTGATGCAACTCGATCACGAAGGTCGAGATCGTGTGGTTTACTACCAATCGCGTCAACTGATGGCAGCTGAGCGCAATTACCCGGTACAT
GACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACGTGGGAGTAGACCATTCGTGGTCTACACCGATCACGCATCGTTGC
GTACGGCGATTAAGTCGCCGCACATATCCCAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTT
GAATGTCGTGGCCGACGCGCTTTCGTGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGACGTCGTCAGAACGACTACACCCTCGTCG
TCCTTGCTGGATGACGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAGTTGTTGGAGTACTGTTCCACACCTTCTGACAAGTCTCGTCAGAAGC
TGGCCAAACACCTTCGTGCTCGCGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCC
GGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTTAGAAGACATACTTGCTTCTCACGCGT
GACTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGTG