Description :
From Genome Similarity Track
Location :
contig_126:50023- 52951
Transcript NameFunction/comments
g13545.t1hypothetical protein
g13546.t1OWZ18425.1 Membrane protein [Phytophthora megakarya

Sequence
2928 bases(100 bases per row)
GCACGCGTACCACGTGCTGAGTCTCTACGGCCGCACCAAGAAGCACCTGCAGAAGCTCTTCCCCGACCCGAGCGACAGCGAGATCGAGTGGCTGCGACTG
CGCACCAAGATGCACGAGATGATCATCGCCCAGCACCTGCGCTTCACTCTAGTGGTGCTGCAGCAAGCCGAGGCGACGGATATCGCCCCAGAACCGGTTG
GGCGTGGACCCGTGGAGGAGACGGCCAACGGATCGAAGGAGGAAGAGAAACCAGTAGCTGCTACGTGATCCTAGAAAGGAGAGGCGAGCTGACTCGTGGC
ACTGCGTGGGCCCAGCAGAGTGAAGGTCGTACTACAAGTCGTACTACTTGAAGTTGAAATCGCAACGACGTAGCGTGTTTACTTAAGAACCGGACCGGAC
TGAGTTTGTTTTCAAGCTGCAGCTGGTGACGGTGGATGTTGGACACAGGGTCGGCGTTGGACACTGGTGCCAGTGGCAGCGTACAGACTCACAATCGACG
CAAGAAGATTAAGATAGGCTGTCCAGCCAGCGGTTAATCTTGGTTCATCTTAAAGTTTGGAACCTCATGGTTCTGATGATCCAGTGGGGTGGTTGCTCCG
TCACTTGGTGGTTTGTGGTGGCCTACACGTTGGCGCTCGCTGGTGCTGTCAATTGATACCCACCACATCGCACCAAGGCGTTTTGCGTGCGTGCGTGTTG
CTGCTGGAAAAGAAACGCCGTTTCTGGACAGCTCTGGATTATAGGTATATGAATGTTGTAGGTGTCGACAGCCCGTCTCAAAAATCGTGGCGTGGCGTGG
CTCTCTTACTCAGAGTCTGACCATCGCACCGATCCACGCGGTAAAGCTCAACTCTTGTCTGCACACTGTACTAACAAAACCCTTACCGCCACACCACCAG
ACCTTACCACACACATTGCAACTGCCAAACCGCTGCACTTAATTAAGCTGATGTTTCTGCCGTTCCCCGGCTCAAAACATGCGATTGCGAAGCCTTCCAC
CAGCGCTTCGAGTTATCATCAACGGCCCGTGATACCCACACCGACCGACTCGACTCGCCCGCCCTCCACAATAGCACCAATAGATAGCACTTCTAAATTT
GCTGTTCGAGCAGCAAAAGCCTCTTCCGACTCACACCTTCGCCAACCGCTATGGGCTTCTTCGACGAACAAGTGGGCGTCAAGGTGCCCCAGGTCACTGT
CTACTTCTGGATCATCAAGGTCCTGGCCACGACGGTCGGTGAGACGTTCGCCGACTTTCTCAACGGAAATGTTGGTCTCGGTCTGGGCGGCACCTCCGGC
ACCATGCTCGCCATCCTCTTGGTGGCACTCGCGGCCCAACTGAAGCTCGACTTCTACTTCCCGCCGCTCTACTGGTTCGTCATCGTCGCCATCAGCACTG
TGGGCACTCTGCTAAGCGACAACCTCACGGACAACCTCGGCGTTTCGCTGTCGGTGACCACCCCCATCTTCCTCAGTCTGCTGGGGGTTGTGTTCCTGGC
ATGGTACCATTCCGAGAAGAACTTGTCCATCCACAGTATCTTCACGCGGCGTCGGGAGGCGTGGTACTGGCTGACCGTGCTCGTCACCTTTGCGTTGGGG
ACGTCGGCGGGAGATCTCATCGCAGAGAAGCTCGACGTTGGCTACGGAAACTCGTTGGTCCTCTTTGCAGGTTGCATCCTGTTCGTGGGGTTACTATGGC
GGTTCAAGGTGATCAACGGGGTGCTCGGCTTCTGGGTGGTGTACGTGCTGACTCGGCCGCTCGGAGCCTCGCTGGGAGACTTGATGTCACAGAACCCGGC
GGACTCGGTGGCCTCGGCTTCGAGCTCCGGGTCGGGCTCATCATCGGCTTCGGCTTCAGCTTCAGCCTCCGAGTCGATGTCTGGGTCTGGCGAGACGGAG
GAGCTCCCTTCCGGTTGGAAGACCGGCCTCAACCTCGGCACGACGGTCACGAGTATGATCTTCTTGGCTCTCATCGCAGTGTTGGTGGCTTTCTTAACCA
TCACGAAGAAGGACGAGCTGAAGGTCGAGTCTATTCACCCTGATCTCGAGAAAGGGGAGGAGCCAGGGGCTACCTCGACCACTTCAGTTCAACACGAGTG
GACGACGCTACCCGACAATGCAGCGCGGTAGACTGTCTTTCAAACTGTGAAGGTACTTTCCCACTAAGACCAATGCGTCGAATCTCAAAACCTACAACAC
CACCCTGTGCATTTGAAACTTGCTTCGTTATACACAATATCAATACGTCGAAAAGAAAGCAAACGAAGTGTATACTTCGTTTATACGCATACTGCGTTGA
GGATTGTTTTGCTATGAATACGTTTGGCATACATGTCCCCGCCTACTCCACACGAGTGATCGGTGCCGACGGGAGCTCGCTCTTCCTCGAGCGCTTGCGC
TTGCGCAGGAAGAAGGTTTTGAGGTCGTGTTAAGTAGTAGTTTGAAGTACTACAGCAGCGTACATGGTCATGTTTGTAATAAAAGGAGTTAAAACCCTTG
ACCAAATTCGTGATCAATTTCAAACTGCCGCTTGCGAAGCCTGGACAATCGTCAACAACAGACAAACCTCTAGCTGGATCTGAAGTGCTGGGTGACAAGG
GAGCTATTTAAGCTACAACAATATAATATATAATATAATTATTGGACGCTCCGCTTGTGTAGCAGAGTGAAGGTCGTACAAGTTGAAGTTACAGTGCAGT
AAGGTGTTTACTTCTGGGTATTTTTTTCTAGTTGCAGCTGTAGAGCGACGTTGGACACAGATGCCAGCGTAACATCCTTTGGTTCACAATCGGCGCCAGC
GCAATCGCATTTCACGTCTGCACTCAAGTGTCCTAACCCTTTTGCATCGTATTCTACGAACAAACAGGGAAAATGGAGTCTTCCTGACAATATGGATAGG
AACAAGTCGTGTTGTTACGCATCGATGT