Description :
From Genome Similarity Track
Location :
Scaffold_9:50006- 51723
Transcript NameFunction/comments
Albla_Nc14013100
Albla_Nc14013120

Sequence
1717 bases(100 bases per row)
TGGGATCTGATGAGTTTGTGATCCGCATTCGGATCATATGCAAACGTGTACCTCCGAATAGATAGAATGATTCTTGATAAACACAGGAGGCATGACCAGA
CCGTGGGGATGGGGCACAGGATGGATTCGTGCAGTCCACCGTCATCCACGGTCGTGGAAAATCTTGCGTCATGAAAAAATTATTTATGCATTCTGCCGGC
ATGATAGCATAGGACAGTTACGAGTAAGAAAACCTGTCCTATCTATCAATCAAAGGCTGCCCCAAACCTCCGCAATTGTGCGACCATAACGCCCGCGGTT
GTCGAATTTAATTTGCTACATGACGCACTGTGAACTACTCTTCTCTGAATGTGATTTCAATGCATAAACGATTAAACGAATTCGTAAAGACCAAAATATT
CAGAGCGACTCGGTTGGTACCTTCCATCCCGTATAAAAATGTATGCAGGTCGCTTAATTGTGCTACCACAGGAAGTAGTTAAGAGAGCCGAGGTAAGAAG
AGCTCAATGTCGACACTGCAAATCTTGGACATAGGATGTTTGAGTATTGGAATCACGTGCGAAGAAAGTCGTGTTTGCTAAAACTGTAGCCGTAGATAAA
ATGGTTTCACTGCACTTGTACATAGTACGGACACATTCAGCGAGCACTTTTGTTTAAGAATATCGCGCCGCGACGAGAAATATGGTCATCTTGAGGCTTT
TTTTGTTGGTGCCATAAAAATATGCTGTACTGTTACTATTTACTATAGCCTGTGTCTTTTGTAGCTTGGTTTAAGATCTGTGACTCAGAAATACAATCTC
TGTGTTGACTTTTTTCGTATTTATCAGCGCTTGAAATCTGCTTTACCGACTTGGTTGGTGGCTGCCAAACTCTTGTGATCTTCCAAGTGATGCATTGCAT
GACGGGCGCTGGAAGCTGCTACCATAGAAAGCTCCTTAGAAACCTGAGGTCATGATAGCTCAATGTGAATGAATGCTTAAATTTGCGATGTGTGAGTATT
GAAGTCATATATGCCTGAAAGTCGTATTGGCTATAACGTTAATTTGTACCCATAGGCGAAGCATGGACATATTTGGCGAGCAATTTCAAGTACATCATTA
TTGGGCTCGGAAAATATGTAACGAAAGTGGCACTACTCCAATCAGGAATTTACTCGAAATCCCGAATTATAGTCCCGATGTCGTCTGAATGAGCTGTAGT
ATGACGATAGCATCTTTGTTTCGTGTTTTGGTTTTGGAATCTATGACATAAGTATAATATTTGTGTACAAAATATACACGTCTATCAGCTTGAAGTATTT
TGACCACCTTTTCTTGATACATCAGTAGCTGGGCTCAACACCGTGTTTGGCAACTCTTCTTTGCTGATGGGAATAATGGGGATGTCTGAGCTATGACTCA
ACGACTATTTGTGGCGCGCTTTTGCTCCACTAGACCACTTTCCTGCGACGACATCGACTAGCTTTCATTGTCTGTTGTGAGATGTTCGTGCTTGGTTTCC
TGAACGTCCATAATGTTCATTTTATATAAGGACGCCCTGTATATTCAACCACTTATGAAAATATATCCGAATAATCTACCAGTGACTAAATAATTCCCGA
ATACAGCAAAACCTGTCTAAAAGGTATAGCCTCTGGACCGGGTAAAAGTTAAAACTTAGACAGGTTAAACCTTTAGACAGGTAGAGCATAGTATTTCCAA
AACATATAGGTCCCAAG